DC40229

Marker Overview
NameDC40229
Genbank IDGQ394680
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 90
Source SequenceMONCS1703
Source Typegenomic
Primer 1DC40229_F: ACTTTTTCCAATTTGATCTCTC
Primer 2DC40229_R: CGTGTTCAAGTGTGCTGA
Publication[view all]
ContactMonsanto
CommentPrimer data obtained in 2009-05
References
External references for this genetic_marker
DatabaseAccession
DB:genbankGQ394680
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr08-3N/AAD_chr.0859.4MON_DC40229aView
2CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr24N/AAD_chr.2422.8DC40229View
3Yumian-1 x 7235, RIL (2015)Y7-RIL_chr08N/AAD_chr.0833.2DC40229aView
4Yumian-1 x 7235, RIL (2015)Y7-RIL_chr24N/AAD_chr.248.5DC40229bView
5CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr24N/ADt.0886.12DC40229-86.122View
Contact
NameDetails
Monsanto
Country:United States
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
DC40229_FDC40229_FGossypium hirsutumprimer
DC40229_RDC40229_RGossypium hirsutumprimer


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
MONCS1703MONCS1703Gossypium hirsutumsequence_feature


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
MON_DC40229aMON_DC40229aGossypium hirsutummarker_locus
DC40229DC40229Gossypium hirsutummarker_locus
DC40229aDC40229aGossypium hirsutummarker_locus
DC40229bDC40229bGossypium hirsutummarker_locus
DC40229DC40229-86.122Gossypium hirsutummarker_locus


Germplasm
Stock NameType
Deltapine 90TBD
Sequence
>DC40229 ID=DC40229|Name=DC40229|organism=Gossypium hirsutum|type=genetic_marker|length=187bp
ACTTTTTCCAATTTGATCTCTCTACTTTTGAGTCTAATATTAAATGCATA
ATATACGTAATTTATGGTTAAAATTTATTGTATTTTGAACTTCTATATAT
GCAAAATATGATTTTTAATTTTTATTTTTTTATACAATGCCTAACCCTTA
AATAAGAGGATAACGCGCTTCAGCACACTTGAACACG