DC40140

Marker Overview
NameDC40140
Genbank IDGQ394637
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 90
Source SequenceMONCS1660
Source Typegenomic
Primer 1DC40140_F: TTTGCCTTCATGCTCCTAC
Primer 2DC40140_R: CAATCCATAGGCATGTGT
Publication[view all]
ContactMonsanto
CommentPrimer data obtained in 2009-05
References
External references for this genetic_marker
DatabaseAccession
DB:genbankGQ394637
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Yumian-1 x T586, RIL (2015)YT-RIL.15_chr06N/AAD_chr.06148.6DC40140View
2CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr06N/AAD_chr.0641.4DC40140View
3(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr06-3N/AAD_chr.064.7MON_DC40140View
4CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr25N/ADt.06109.05DC40140-109.052View
Contact
NameDetails
Monsanto
Country:United States
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
DC40140_FDC40140_FGossypium hirsutumprimer
DC40140_RDC40140_RGossypium hirsutumprimer


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
MONCS1660MONCS1660Gossypium hirsutumsequence_feature


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
DC40140DC40140Gossypium hirsutummarker_locus
MON_DC40140MON_DC40140Gossypium hirsutummarker_locus
DC40140DC40140-109.052Gossypium hirsutummarker_locus


Germplasm
Stock NameType
Deltapine 90TBD
Sequence
>DC40140 ID=DC40140|Name=DC40140|organism=Gossypium hirsutum|type=genetic_marker|length=350bp
TTTGCCTTCATGCTCCTACAGAGAAAAAAAAAGTGAAGAGAGAGTGGGAG
AGAGAGAATTCTGGATTAGCTGGGATTTAAATCGGTAGAGCAGCCTCATG
TCAGGAAAACTGCAATATGCTGAAAAGTCAATAAATCCACATAGAAATAT
AGGCAGAGTAGATGTATGGAAAGCAGACTGATATTTATCCTGAAATCCAA
AGACTGCTAATTGAAACGGGTCTATGATGTTTATCCTGACATTCAAACTT
CGCTAATTGAAGCAGAGACCATAGTTCTAAATTACAATCAGTTTATACAC
TCTCTAAGGATCTAAATGTAACTTTTAGTGGGACACATGCCTATGGATTG