DC20124

Marker Overview
NameDC20124
Genbank IDGQ394503
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 90
Source SequenceMONCS1526
Source Typegenomic
Primer 1DC20124_F: GCAAACTCGGGATAACACA
Primer 2DC20124_R: AAAATGATACTTTGGGTCAAG
Publication[view all]
ContactMonsanto
CommentPrimer data obtained in 2009-05
References
External references for this genetic_marker
DatabaseAccession
DB:genbankGQ394503
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr07N/AAD_chr.0770DC20124aView
2TM-1 x 3-79, RIL (2014)T3-RIL.14_chr07N/AAD_chr.0789DC20124aView
3Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr16N/AAD_chr.16150DC20124cView
4TM-1 x 3-79, RIL (2014)T3-RIL.14_chr16N/AAD_chr.1682.9DC20124cView
5GX1135 x GX100-2, RIL (2016)GG-RIL.16_chr16N/AAD_chr.1679.9DC20124View
6CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr16N/AAD_chr.1687.8DC20124View
7CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr16N/ADt.0764.22DC20124-64.224View
8TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.07N/AAD_chr.0788.98DC20124a-88.978View
9TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.16N/AAD_chr.1682.88DC20124c-82.879View
Contact
NameDetails
Monsanto
Country:United States
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
DC20124_FDC20124_FGossypium hirsutumprimer
DC20124_RDC20124_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
DC20124aDC20124aGossypium hirsutummarker_locus
DC20124cDC20124cGossypium hirsutummarker_locus
DC20124DC20124Gossypium hirsutummarker_locus
DC20124DC20124-64.224Gossypium hirsutummarker_locus
DC20124aDC20124a-88.978Gossypium hirsutummarker_locus
DC20124cDC20124c-82.879Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
MONCS1526MONCS1526Gossypium hirsutumsequence_feature


Germplasm
Stock NameType
Deltapine 90TBD
Sequence
>DC20124 ID=DC20124|Name=DC20124|organism=Gossypium hirsutum|type=genetic_marker|length=174bp
GCAAACTCGGGATAACACAGGTGTCTGTTGAAATTACACACACACACACA
CACACACACATGCTAATTTCTAACAAGTATTTCTATGTAGGCTACGATTG
CGCATGCTTTAGAGAAGACGAAATACGAGGATTCAGACATCAAGTGGAAG
GAACTTGACCCAAAGTATCATTTT