CIR0194

Marker Overview
NameCIR0194
AliasCIR194
Genbank IDAJ567141
TypeSSR
SpeciesGossypium hirsutum
GermplasmGuazuncho-2
Source SequenceAJ567141
Source Typegenomic
Repeat Motif(CA)7
PCR ConditionAnnealing temperature: 55
Primer 1CIR194_F: ATTGTCTTGGACTTTGGT
Primer 2CIR194_R: TCAGTTGAAAGTATTCCCT
Product Length139
PolymorphismP_ CIR0194
Publication[view all]
CommentPrimer data obtained in 2005
References
External references for this genetic_marker
DatabaseAccession
DB:genbankAJ567141
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1(Simian-3 x Sumian-12) x (Zhong-4133 x 8891), 4WC (2008) part(Simian-3 x Sumian-12) x (Zhong-4133 x 8891), 4WC (2008) part.SSZ8-4WC_D09N/AAD_chr.23100.6CIR194View
2CCRI-36 x Hai-7124, F2 (2007)CCRI-36 x Hai-7124, F2 (2007).CH-F2_chr23N/AAD_chr.2367.8CIR194View
3Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c23N/AAD_chr.23102.54CIR194View
4Zhongmiansuo-12 x 8891, RIL (2007)Zhongmiansuo-12 x 8891, RIL (2007).Z8-RIL_ch23/D09N/AAD_chr.2361.5CIR194View
5Guazuncho-2 x VH8-4602, BC1 (2005)Guazuncho-2 x VH8-4602, BC1 (2005).GV-BC1_chr23N/AAD_chr.23174.4CIR194View
6Yumian-1 x T586, RIL (2006)YT-RIL_chr23-1N/AAD_chr.2328.1CIR194View
7Yumian-1 x T586, RIL (2015)YT-RIL.15_chr23N/AAD_chr.2368.9CIR194View
8CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr23N/AAD_chr.2334.2CIR194View
9AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr23N/AAD_chr.23147cir0194View
10Yumian-1 x T586, RIL (2009)YT-RIL_chr23-2N/AAD_chr.2328.1CIR194/190y(C23)View
11CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr23N/ADt.09157.35CIR194-157.346View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
CIR194_FCIR194_FGossypium hirsutumprimer
CIR194_RCIR194_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CIR194CIR194Gossypium hirsutummarker_locus
cir0194cir0194Gossypium hirsutummarker_locus
CIR194/190y(C23)CIR194/190y(C23)Gossypium hirsutummarker_locus
CIR194CIR194-157.346Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
AJ567141AJ567141Gossypium hirsutumsequence_feature


Germplasm
Stock NameType
Guazuncho-2TBD
Sequence
>CIR0194 ID=CIR0194|Name=CIR0194|organism=Gossypium hirsutum|type=genetic_marker|length=139bp
ATTGTCTTGGACTTTGGTCAGTGTTCTTGCACACACACACACACTTTTTT
TCAAAATATTATTTTAAAGCTTCTTTGATGGTAAAAAAGAATCTTGTTGA
TTTCTTTTACTCTCTTCTATAGGGAATACTTTCAACTGA