CCRI_SNP073050

Marker Overview
NameCCRI_SNP073050
AliasCRI-SNP073050
dbSNP IDN/A
TypeSNP
SNP AllelesN/A
SpeciesGossypium spp.
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
10-153 x sGK9708, RIL (2015)0s-RIL.15_chr25N/AAD_chr.2519.13CRI-SNP73050View
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CRI-SNP73050CRI-SNP73050Gossypium spp.marker_locus


Sequence
>CCRI_SNP073050 ID=CCRI_SNP073050|Name=CCRI_SNP073050|organism=Gossypium spp.|type=genetic_marker|length=170bp
AATAATGTTTGCTTTTTAAAAGCTAGTGGCGTTTTTTGTTAACGCCGCTA
AAGGACATGATCTTTAGCGACGTTCGAGATXXXXXXXXXXGCGATGTTTA
TAGCAGCATTTTTTGCGGCGCTTGTGAAAGCGCTGCAAATAGTTTTAGCG
GCGCATAAAAATACCGCTAT