CCRI_SNP_mk539_A01

Marker Overview
NameCCRI_SNP_mk539_A01
Aliasmk539_A01
dbSNP IDN/A
TypeSNP
SNP AllelesA/C/G/T
5' Flanking SequenceAATTTGTGGTCTCAAAACCACTGTTCTGATTTGACCCAAAAACGGGCTATTACAACTCTC CCCCCTTTTGGGATTTTCATCCCCGAAAATCTTACTAGAAAAGAGGTTAGGGTACTATTT TCTCATAGCTTCTTCGAGTTTCCACATAGC
3' Flanking SequenceTATTCGTCCCCGTGTCATTGCCACAAAACTTTCACTAGTGCTATTTCTCAACTGTTTAAC CTCTCGAGCTAACACTTTTATCGGTTCTTCACCATATGTCCTATCGGGTTGAATCACAAT CTCTGTTGGAGAAATCACATGCGAAGGATC
SpeciesGossypium hirsutum
Publication[view all]
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1CCRI-35 x NH, F2:3 (2018)CN-F2:3_chr01N/AAD_chr.0116.58mk539_A01View
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
mk539_A01mk539_A01Gossypium hirsutummarker_locus


Sequence
>CCRI_SNP_mk539_A01 ID=CCRI_SNP_mk539_A01|Name=CCRI_SNP_mk539_A01|organism=Gossypium hirsutum|type=genetic_marker|length=309bp
AATTTGTGGTCTCAAAACCACTGTTCTGATTTGACCCAAAAACGGGCTAT
TACAACTCTCCCCCCTTTTGGGATTTTCATCCCCGAAAATCTTACTAGAA
AAGAGGTTAGGGTACTATTTTCTCATAGCTTCTTCGAGTTTCCACATAGC
[A/C/G/T]TATTCGTCCCCGTGTCATTGCCACAAAACTTTCACTAGTGC
TATTTCTCAACTGTTTAACCTCTCGAGCTAACACTTTTATCGGTTCTTCA
CCATATGTCCTATCGGGTTGAATCACAATCTCTGTTGGAGAAATCACATG
CGAAGGATC