SWU10986

Marker Overview
NameSWU10986
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
Primer 1SWU10986_F: TGGTACGGGTTTGAATCGT
Primer 2SWU10986_R: GCGTGACTTCACCGTTACAT
Publication[view all]
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1GX1135 x GX100-2, RIL (2016)GG-RIL.16_chr01-1N/AAD_chr.0147.9SWU10986View
20-153 x sGK9708, RIL (2016)0s-RIL_chr01-1N/AAD_chr.010SWU10986View
3CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr15N/ADt.0119.99SWU10986-19.992View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
SWU10986_FSWU10986.SWU10986_FGossypium hirsutumprimer
SWU10986_RSWU10986.SWU10986_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SWU10986SWU10986Gossypium hirsutummarker_locus
SWU10986SWU10986-19.992Gossypium hirsutummarker_locus