EX171805.1

Sequence Feature Overview
NameEX171805.1
Unique NameEX171805.1
TypeSequence
OrganismGossypium spp.
>EX171805.1
CTATGTGAGGCGCNTTACAAATGCAGGTCGACACTAGTGGATCCAAAGAATTCGGCACGA
GGAGATTCGGAAAAAGAAATGTGTCCGCTGAGGCTGATCCTCATATTCCTGTCGGCAACA
CTCGCCGGATTTTTCCTCCTTAGAAACATCAAATGCCACCCCCAAACCAACGATGACGAT
CATACCCGCCCCAACAACAATAACTCCCACTCTGCTTTCTCCAAGGTTTCTACTTCTTCT
TCTTCTTCTTCTCCCGCTTGTAATTAACAGTCAATGCTTCAATTTGTTGGACTAGGTTTG
GGCAGCTATAGAATCAGGATTCTGGGCATCTCTTGACATGGCAAGTGGTCGTTACTTGTG
GAGGCATCTGGTTTCCTCTAACTCCAAGCCTTCCTCTTGATTCTGCAAAAAAAACCATTC
TTTGGTGTGTCCCTGCTGTTTCCCATTCTTCTACTACTGTTGTACATATCTCCTGGATCT
TTTGGATGCATTGTGGGAATTGAACTTCTTCTCAACTTATACTGTTTGTTAAGAGATTTC
TTTGTCTGCTTTGCTTTGGAACTTGTCCTTTTTCTTCTCATTATACTCAACTCTGTCAGN
TGTAAGNTGGCAAATTTCTTCATTTCCTTGAATATTTGCTCCTCCTACACAGATTTCGTG
TCAACCTATGGGTATCTTATGTCTAAATAAACTATGAACNAAGACCTTATTATGACTTTG
GTCTTGGACTCNAAAAAAAAAAAAAAAAATCGNGGGNNTTTTAAAGGGGCGGGGGNCCAT
GATTTCCCCCGGGGGGNCNGAGGCCTNAT
Relationships

This sequence_feature derives from the following genetic_marker feature(s):

Feature NameUnique NameSpeciesType
HAU2605HAU2605Gossypium spp.genetic_marker