CGR5995

Marker Overview
NameCGR5995
Genbank IDGQ393850
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 33 B
Source SequenceMONCS0815
Source Typegenomic
PCR ConditionAnnealing temperature: 55
Primer 1CGR5995_F: GCAAGTCCGGTTTCGAGTAT
Primer 2CGR5995_R: TAATGAGCCTTTGACCGGAG
Publication[view all]
ContactMonsanto
CommentPrimer data obtained in 2009-05
References
External references for this genetic_marker
DatabaseAccession
DB:genbankGQ393850
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Yumian-1 x T586, RIL (2015)YT-RIL.15_chr01N/AAD_chr.0122CGR5995aView
2Yumian-1 x T586, RIL (2015)YT-RIL.15_chr02N/AAD_chr.0278.2CGR5995bView
3CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr01N/AAt.01128.8CGR5995View
4CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr02N/AAD_chr.0247CGR5995View
5CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr02N/AAt.0264.44CGR5995-64.444View
Contact
NameDetails
Monsanto
Country:United States
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
CGR5995_FCGR5995_FGossypium hirsutumprimer
CGR5995_RCGR5995_RGossypium hirsutumprimer


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
MONCS0815MONCS0815Gossypium hirsutumsequence_feature


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CGR5995aCGR5995aGossypium hirsutummarker_locus
CGR5995bCGR5995bGossypium hirsutummarker_locus
CGR5995CGR5995Gossypium hirsutummarker_locus
CGR5995CGR5995-64.444Gossypium hirsutummarker_locus


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
CM017693.1chromosomeCM017693.1:7608515..7608665 -
CM017641.1chromosomeCM017641.1:7428582..7428740 -
CM017615.1chromosomeCM017615.1:7564306..7564462 -
A06chromosomeA06:7363833..7363987 -
Gbar_A02chromosomeGbar_A02:75529590..75529715 -
Gbar_A06chromosomeGbar_A06:7335615..7335769 -
scaffold19103supercontigscaffold19103:185999..186153 -
scaffold584supercontigscaffold584:101224..101349 -
At02chromosomeAt02:65306743..65306868 -
At06chromosomeAt06:6828519..6828673 -
A06chromosomeA06:7424972..7425128 -
A06chromosomeA06:7490331..7490485 -
A06chromosomeA06:7207338..7207492 -
Ghir_A06chromosomeGhir_A06:7573387..7573539 -
A06chromosomeA06:6130025..6130179 -
At_chr10chromosomeAt_chr10:67213643..67213797 -
Chr06_CRI-A2_v1.0.a1chromosomeChr06_CRI-A2_v1.0.a1:5716516..5716686 -
Chr8chromosomeChr8:45922645..45922817 +
CM018207.1chromosomeCM018207.1:7520338..7520492 -
A06chromosomeA06:7256129..7256283 -
Germplasm
Stock NameType
Deltapine 33 BTBD
Sequence
>CGR5995 ID=CGR5995|Name=CGR5995|organism=Gossypium hirsutum|type=genetic_marker|length=153bp
GCAAGTCCGGTTTCGAGTATAATACACACACACACACACACACACATATA
TACAGAGAGAGATTCAAAAAAGGAGAAGAAGAGGGGAAAGGATTTTCTTA
CGGATTCGGTGTCGATTCATTCCACCGTTGCCTCTCCGGTCAAAGGCTCA
TTA