CGR5758

Marker Overview
NameCGR5758
Genbank IDGQ393721
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 33 B
Source SequenceMONCS0686
Source Typegenomic
PCR ConditionAnnealing temperature: 55
Primer 1CGR5758_F: AAACAATAGCTTTCGCAGCC
Primer 2CGR5758_R: TGTAACAATCACCAGGCACC
Publication[view all]
ContactMonsanto
CommentPrimer data obtained in 2009-05
References
External references for this genetic_marker
DatabaseAccession
DB:genbankGQ393721
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr09N/AAD_chr.0970CGR5758View
2GX1135 x GX100-2, F2 (2013)GG-F2_chr09N/AAD_chr.0974CGR5758View
3GX1135 x GX100-2, RIL (2015)GG-RIL.15_chr09N/AAD_chr.09131.4CGR5758View
4GX1135 x GX100-2, RIL (2016)GG-RIL.16_chr09N/AAD_chr.09131.4CGR5758View
5CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr23N/AAD_chr.2344.3CGR5758View
6(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr23-2N/AAD_chr.23102.5MON_CGR5758View
7CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr23N/ADt.09141.02CGR5758-141.015View
Contact
NameDetails
Monsanto
Country:United States
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
CGR5758_FCGR5758_FGossypium hirsutumprimer
CGR5758_RCGR5758_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CGR5758CGR5758Gossypium hirsutummarker_locus
MON_CGR5758MON_CGR5758Gossypium hirsutummarker_locus
CGR5758CGR5758-141.015Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
MONCS0686MONCS0686Gossypium hirsutumsequence_feature


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Chr06chromosomeCGR5758:1..464 .
Chr06:41841275..41841735 -
Chr6chromosomeCGR5758:1..464 .
Chr6:34004159..34004619 +
Germplasm
Stock NameType
Deltapine 33 BTBD
Sequence
>CGR5758 ID=CGR5758|Name=CGR5758|organism=Gossypium hirsutum|type=genetic_marker|length=122bp
AAACAATAGCTTTCGCAGCCTTTTCCTTTTTCCTTCTTCTTCTTCTTCTT
CTTTTTCCTTTTTAACTTCTGTGGGTGTTGAAGAAGAAAGCTTTCAGCTT
TAGGTGCCTGGTGATTGTTACA