CGR5573

Marker Overview
NameCGR5573
Genbank IDGQ393572
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 33 B
Source SequenceMONCS0537
Source Typegenomic
PCR ConditionAnnealing temperature: 55
Primer 1CGR5573_F: GATTCTAAGCCCAAAGTATCTGGT
Primer 2CGR5573_R: AGCCAAATGCACCATCTCAT
Publication[view all]
ContactMonsanto
CommentPrimer data obtained in 2009-05
References
External references for this genetic_marker
DatabaseAccession
DB:genbankGQ393572
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr16N/AAD_chr.16110CGR5573View
2TM-1 x (TX-0256 + TX-1046), CSIL (2016)TTT-CSIL_chr16N/AAD_chr.1656CGR5573View
3CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr16N/ADt.0752.8CGR5573View
4CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr16N/AAD_chr.16100.7CGR5573View
5CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr16N/ADt.07114.39CGR5573-114.391View
Contact
NameDetails
Monsanto
Country:United States
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
CGR5573_FCGR5573_FGossypium hirsutumprimer
CGR5573_RCGR5573_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CGR5573CGR5573Gossypium hirsutummarker_locus
CGR5573CGR5573-114.391Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
MONCS0537MONCS0537Gossypium hirsutumsequence_feature


Germplasm
Stock NameType
Deltapine 33 BTBD
Sequence
>CGR5573 ID=CGR5573|Name=CGR5573|organism=Gossypium hirsutum|type=genetic_marker|length=166bp
GATTCTAAGCCCAAAGTATCTGGTACGAAGAAGAAGAAGAAGAAGAAGAA
GAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAATAAGA
AGAAGAAGAAAAAGAAGAAGAAGAAATAAAGATGAACTAAGAAGAGATGA
GATGGTGCATTTGGCT