CGR5553

Marker Overview
NameCGR5553
AliasNBRI_GE60067
CGR5553=RC(NBRI_GE60067)
Genbank IDGQ393555
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 33 B
Source SequenceMONCS0520
Source Typegenomic
PCR ConditionAnnealing temperature: 55
Primer 1CGR5553_F: CCTGACTACGGGTGAAGGAA
Primer 2CGR5553_R: ACCGAGCAATAATCCAGCAG
Publication[view all]
ContactMonsanto
CommentPrimer data obtained in 2009-05
References
External references for this genetic_marker
DatabaseAccession
DB:genbankGQ393555
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr05N/AAD_chr.0530CGR5553View
20-153 x sGK9708, RIL (2016)0s-RIL_chr05-2N/AAD_chr.05129.3CGR5553View
3GX1135 x VGX100-2, RIL (2016)GVG-RIL_chr05N/AAD_chr.0529.1CGR5553View
4CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr05N/AAt.05210.2CGR5553View
5(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr05-2N/AAD_chr.0558.1MON_CGR5553View
Contact
NameDetails
Monsanto
Country:United States
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
CGR5553_FCGR5553_FGossypium hirsutumprimer
CGR5553_RCGR5553_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CGR5553CGR5553Gossypium hirsutummarker_locus
MON_CGR5553MON_CGR5553Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
MONCS0520MONCS0520Gossypium hirsutumsequence_feature


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Chr12chromosomeCGR5553:8..464 .
Chr12:5025511..5025958 +
Chr12chromosomeCGR5553:8..464 .
Chr12:21247111..21247558 -
Germplasm
Stock NameType
Deltapine 33 BTBD
Sequence
>CGR5553 ID=CGR5553|Name=CGR5553|organism=Gossypium hirsutum|type=genetic_marker|length=140bp
CCTGACTACGGGTGAAGGAAGAAACTAAGTCTTGTAATAAGCCATAATCA
CGAACTTGAAGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGGGTTTGATG
ATGCATGGAGTTGGCGTGTGCTGCTGGATTATTGCTCGGT