CGR5498

Marker Overview
NameCGR5498
Genbank IDGQ393509
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 33 B
Source SequenceMONCS0474
Source Typegenomic
PCR ConditionAnnealing temperature: 55
Primer 1CGR5498_F: GGGACTACCCACTGCCTTT
Primer 2CGR5498_R: AATGACGCCTCCTCCTCCT
Publication[view all]
ContactMonsanto
CommentPrimer data obtained in 2009-05
References
External references for this genetic_marker
DatabaseAccession
DB:genbankGQ393509
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr04N/AAD_chr.0490CGR5498View
2CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr04N/AAD_chr.0475.5CGR5498View
3CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr04N/AAt.0437.22CGR5498-37.219View
Contact
NameDetails
Monsanto
Country:United States
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
CGR5498_FCGR5498_FGossypium hirsutumprimer
CGR5498_RCGR5498_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CGR5498CGR5498Gossypium hirsutummarker_locus
CGR5498CGR5498-37.219Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
MONCS0474MONCS0474Gossypium hirsutumsequence_feature


Germplasm
Stock NameType
Deltapine 33 BTBD
Sequence
>CGR5498 ID=CGR5498|Name=CGR5498|organism=Gossypium hirsutum|type=genetic_marker|length=169bp
GGGACTACCCACTGCCTTTTCTTTTGTTTTATTATGTGTTTGGGGACCTT
AAAATGGTCCCCAATTTCTTTGTGTGCGTGAGTGAAGAAGAAGGGGGAAG
GAGAAGAGAAAGAGAAGAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA
AGGAGGAGGAGGCGTCATT