CGR5258

Marker Overview
NameCGR5258
Genbank IDGQ393371
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 33 B
Source SequenceMONCS0336
Source Typegenomic
PCR ConditionAnnealing temperature: 55
Primer 1CGR5258_F: AACCAGTCTGGAAGATGGCA
Primer 2CGR5258_R: CCTGAACGTCATCACCCTCT
Publication[view all]
ContactMonsanto
CommentPrimer data obtained in 2009-05
References
External references for this genetic_marker
DatabaseAccession
DB:genbankGQ393371
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr03N/AAD_chr.0390CGR5258View
2Yumian-1 x T586, RIL (2015)YT-RIL.15_chr14N/AAD_chr.14120.7CGR5258View
3W10 x TM-1, F2:3 (2015)WT-F2:3_chr14-1N/AAD_chr.1429CGR5258View
4CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr14N/AAD_chr.143.7CGR5258View
5Yumian-1 x 7235, RIL (2015)Y7-RIL_chr14N/AAD_chr.1479.1CGR5258bView
60-153 x sGK9708, RIL (2016)0s-RIL_chr14-2N/AAD_chr.1492.6CGR5258bView
7Yumian-1 x 7235, RIL (2015)Y7-RIL_chr03N/AAD_chr.03111.2CGR5258aView
80-153 x sGK9708, RIL (2016)0s-RIL_chr14-2N/AAD_chr.1493.9CGR5258aView
9CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr14N/ADt.02100.87CGR5258-100.869View
Contact
NameDetails
Monsanto
Country:United States
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
CGR5258_FCGR5258_FGossypium hirsutumprimer
CGR5258_RCGR5258_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CGR5258CGR5258Gossypium hirsutummarker_locus
CGR5258bCGR5258bGossypium hirsutummarker_locus
CGR5258aCGR5258aGossypium hirsutummarker_locus
CGR5258CGR5258-100.869Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
MONCS0336MONCS0336Gossypium hirsutumsequence_feature


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Chr05chromosomeCGR5258:5..266 .
Chr05:57949124..57949391 +
Chr5chromosomeCGR5258:5..266 .
Chr5:37035058..37035325 +
Germplasm
Stock NameType
Deltapine 33 BTBD
Sequence
>CGR5258 ID=CGR5258|Name=CGR5258|organism=Gossypium hirsutum|type=genetic_marker|length=126bp
AACCAGTCTGGAAGATGGCAAAGAAGAAGAAGAAGAAGAAGAAGAAGAAG
AAGAAGAAGAAGAAGAAGAGGGTGAAGAGTGATGAGCCAAAGAAGCAGAG
GATGGAAGAGGGTGATGACGTTCAGG