CGR5090

Marker Overview
NameCGR5090
Genbank IDGQ393234
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 33 B
Source SequenceMONCS0199
Source Typegenomic
PCR ConditionAnnealing temperature: 55
Primer 1CGR5090_F: GTTATGGAGCTGGAGGTGGA
Primer 2CGR5090_R: CCAGTTCCAATTCCACCAGT
Publication[view all]
ContactMonsanto
CommentPrimer data obtained in 2009-05
References
External references for this genetic_marker
DatabaseAccession
DB:genbankGQ393234
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr14N/AAD_chr.14130CGR5090View
2CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr02N/AAD_chr.0281.4CGR5090View
3CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr02N/AAt.0231.32CGR5090-31.317View
Contact
NameDetails
Monsanto
Country:United States
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
CGR5090_FCGR5090_FGossypium hirsutumprimer
CGR5090_RCGR5090_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CGR5090CGR5090Gossypium hirsutummarker_locus
CGR5090CGR5090-31.317Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
MONCS0199MONCS0199Gossypium hirsutumsequence_feature


Germplasm
Stock NameType
Deltapine 33 BTBD
Sequence
>CGR5090 ID=CGR5090|Name=CGR5090|organism=Gossypium hirsutum|type=genetic_marker|length=199bp
GTTATGGAGCTGGAGGTGGAACTGGTGGAGCTAGAGGAGTTGGTGGTGAT
GGAACTGGAACTGGTAGTGGAATTGGAACTGGAACTGGAACTGGAACTGG
TGGTGAAACTGGAGCTGGTGGTGGTGGAACTGGAGCTGGAACTGGTGGTG
GTGGTGGTGGAACTGGAACTAGAGCTGGAACTGGTGGAATTGGAACTGG