CER0167

Marker Overview
NameCER0167
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
Source TypeEST
PCR ConditionAnnealing temperature: 55
Primer 1CER0167_F: TGAAAAGCCCTTTACCAACAA
Primer 2CER0167_R: TCCTTTTCAGCTCTCCTATCTCA
Publication[view all]
ContactMonsanto
CommentPrimer data obtained in 2009-05
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Yumian-1 x T586, RIL (2015)YT-RIL.15_chr20N/AAD_chr.2071.8CER0167View
2GX1135 x GX100-2, RIL (2016)GG-RIL.16_chr20N/AAD_chr.2081.9CER0167View
3GX1135 x VGX100-2, RIL (2016)GVG-RIL_chr20-2N/AAD_chr.209.9CER0167View
4CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr20N/AAD_chr.2090.9CER0167View
5(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr20-3N/AAD_chr.2025.5MON_CER0167View
6GX1135 x GX100-2, F2 (2013)GG-F2_chr13N/AAD_chr.13186.8CER167View
7CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr20N/ADt.1061.62CER0167-61.617View
Contact
NameDetails
Monsanto
Country:United States
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
CER0167_FCER0167_FGossypium hirsutumprimer
CER0167_RCER0167_RGossypium hirsutumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
2.5 span lengthqSL2.5.GVG-RIL_ch20-2.hd12-bcGossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CER0167CER0167Gossypium hirsutummarker_locus
MON_CER0167MON_CER0167Gossypium hirsutummarker_locus
CER167CER167Gossypium hirsutummarker_locus
CER0167CER0167-61.617Gossypium hirsutummarker_locus