CER0112

Marker Overview
NameCER0112
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
Source SequenceMONCS0116
Source TypeEST
PCR ConditionAnnealing temperature: 55
Primer 1CER0112_F: GTGGTGCCATCATCATCATC
Primer 2CER0112_R: TTGTTCCAAAAGCAACCATTA
Publication[view all]
ContactMonsanto
CommentPrimer data obtained in 2009-05
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr16-1N/AAD_chr.1640.1MON_CER0112View
2W10 x TM-1, F2:3 (2015)WT-F2:3_chr16-3N/AAD_chr.160CER0112View
30-153 x sGK9708, RIL (2016)0s-RIL_chr16N/AAD_chr.1617.4CER0112View
4CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr16N/AAD_chr.1625.1CER0112View
5CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr16N/ADt.079.4CER0112-9.399View
Contact
NameDetails
Monsanto
Country:United States
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
CER0112_FCER0112_FGossypium hirsutumprimer
CER0112_RCER0112_RGossypium hirsutumprimer


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
MONCS0116MONCS0116Gossypium hirsutumsequence_feature


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
MON_CER0112MON_CER0112Gossypium hirsutummarker_locus
CER0112CER0112Gossypium hirsutummarker_locus
CER0112CER0112-9.399Gossypium hirsutummarker_locus


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Chr01chromosomeCER0112:1..283 .
Chr01:1411441..1411705 +
scaffold62supercontigCER0112:1..283 .
scaffold62:1301630..1301894 -
Sequence
>CER0112 ID=CER0112|Name=CER0112|organism=Gossypium hirsutum|type=genetic_marker|length=131bp
GTGGTGCCATCATCATCATCATCATCATCATCATCATCATCATCATCATC
ATCATCATCAAATCTTTGATATGTTGTTAACTACAAAGAAAACCTTGTTA
CTTGCTTAATTAATGGTTGCTTTTGGAACAA