BNL4029

Marker Overview
NameBNL4029
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 90
Source SequenceBNL4029_orig
Source Typegenomic
Repeat Motif(TG)12, (AC)10
PCR ConditionAnnealing temperature: 55
Primer 1BNL4029_F: CGAGGGATAGAGAGGACGAA
Primer 2BNL4029_R: GTTTGATTATTATGCTTGTAAAGTTACC
PolymorphismP_ BNL4029
CommentPrimer data obtained in 2000
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1CCRI-36 x Hai-7124, F2 (2007)CCRI-36 x Hai-7124, F2 (2007).CH-F2_A01N/AAD_chr.1378.9BNL4029aView
2Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr13N/AAD_chr.1390BNL4029aView
3TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c13N/AAD_chr.1376.42BNL4029aView
4TM-1 x 3-79, RIL (2014)T3-RIL.14_chr13N/AAD_chr.1372.7BNL4029aView
5CCRI-36 x Hai-7124, F2 (2007)CCRI-36 x Hai-7124, F2 (2007).CH-F2_chr18N/AAD_chr.18121.9BNL4029bView
6Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr18N/AAD_chr.1870BNL4029bView
7TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c18N/AAD_chr.1847.97BNL4029bView
8TM-1 x 3-79, RIL (2014)T3-RIL.14_chr18N/AAD_chr.1848.8BNL4029bView
9Deltapine-61 x Texas-701, F2 (2007)Deltapine-61 x Texas-701, F2 (2007).DT-F2_chr.13N/AAD_chr.1313.7BNL4029-403View
10Deltapine-61 x Texas-701, F2 (2007)Deltapine-61 x Texas-701, F2 (2007).DT-F2_chr.13N/AAD_chr.1322BNL4029-244View
11Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr13N/AAD_chr.13106.04BNL4029View
12Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c13N/AAD_chr.1381.69BNL4029View
13Guazuncho-2 x VH8-4602, RIL (2009)Guazuncho-2 x VH8-4602, RIL (2009).GV-RIL_ch13/lgA01N/AAD_chr.1332.48BNL4029View
14AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr18N/AAD_chr.1814BNL4029View
15Yumian-1 x T586, F2:3 (2005)Yumian-1 x T586, F2:3 (2005).YT-F2:3_A01N/AAD_chr.130BNL4029View
16Yumian-1 x T586, F2:7 (2008)Yumian-1 x T586, RIL (2008).YT-RIL_chr13N/AAD_chr.136.9BNL4029View
17AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr13N/AAD_chr.1370BNL4029View
18Yumian-1 x T586, RIL (2006)YT-RIL_chr13-2N/AAD_chr.1320.7BNL4029View
19Yumian-1 x T586, F2:3 (2005.v0)YT-F2:3_chr01N/AAD_chr.010BNL4029View
20Yumian-1 x T586, F2:3 (2005.v0)YT-F2:3_chr13N/AAD_chr.130BNL4029View
21H18 x TM-1, F2 (2005)H18TM1-F2_chr13N/AAD_chr.13108.4BNL4029View
22DH962 x Jinmian-6, F2 (2009)DJ-F2_chr18.1N/AAD_chr.1822.5BNL4029View
23DH962 x Jinmian-6, F2 (2009)DJ-F2_chr18/LG21N/AAD_chr.1822.5BNL4029View
24Yumian-1 x T586, RIL (2015)YT-RIL.15_chr13N/AAD_chr.1370.2BNL4029View
25DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr25-1N/AAD_chr.2576.63BNL4029View
26Emian-22 x 3-79, BC1 (2015)E3-BC1-2015_chr13N/AAD_chr.13100.3BNL4029View
27CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr13N/AAt.1384.6BNL4029View
28TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr13/A13N/AAD_chr.1340.5BNL4029-245View
29Vsg x (TM-1 x Hai-7124), DH (2005)Vsg x (TM-1 x Hai-7124), DH (2005).VTH-DH.05_lgA01N/AAD_chr.1318.8BNL4029-245View
30TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr13N/AAD_chr.1379BNL4029-245View
31Yumian-1 x T586, RIL (2009)YT-RIL_chr13-2N/AAD_chr.139.1BNL4029/270y(C13)View
32TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.13N/AAD_chr.1372.72BNL4029a-72.722View
33TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.18N/AAD_chr.1848.78BNL4029b-48.78View
34PD 94042 x (AD)4-08, F2 (2016)PA-F2_chr13N/AAt.1317.3BNL4029-17.3View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
BNL4029_FBNL4029_FGossypium hirsutumprimer
BNL4029_RBNL4029_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BNL4029aBNL4029aGossypium hirsutummarker_locus
BNL4029bBNL4029bGossypium hirsutummarker_locus
BNL4029-403BNL4029-403Gossypium hirsutummarker_locus
BNL4029-244BNL4029-244Gossypium hirsutummarker_locus
BNL4029BNL4029Gossypium hirsutummarker_locus
BNL4029-245BNL4029-245Gossypium hirsutummarker_locus
BNL4029/270y(C13)BNL4029/270y(C13)Gossypium hirsutummarker_locus
BNL4029aBNL4029a-72.722Gossypium hirsutummarker_locus
BNL4029bBNL4029b-48.78Gossypium hirsutummarker_locus
BNL4029BNL4029-17.3Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
BNL4029_origBNL4029_origGossypium hirsutumsequence_feature


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Chr13chromosomeBNL4029:1..402 .
Chr13:38846704..38847370 -
scaffold216supercontigBNL4029:1..402 .
scaffold216:688474..689023 +
Germplasm
Stock NameType
Deltapine 90TBD
Sequence
>BNL4029 ID=BNL4029|Name=BNL4029|organism=Gossypium hirsutum|type=genetic_marker|length=247bp
CGAGGGATAGAGAGGACGAAAGTACCAAAATTGCTTCAAAAACAAAACTA
AAGGAGCAAGGTCTGTTTGTCTATTTTTTCTCCATTTTGAAAATTCGAGG
AAATTTATCTATATGCAAAAAGAAAATGCAGTACAATATTCAGCAGCATC
AATATCCAATAAATCCACATTGTTCATATAATTAGATATGTGTGTGTGTG
TGTGTGTGTGTGAGAGACAGGTAACTTTACAAGCATAATAATCAAAC