BNL3992

Marker Overview
NameBNL3992
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 90
Source SequenceBNL3992_orig
Source Typegenomic
Repeat Motif(TC)26, (GA)26
PCR ConditionAnnealing temperature: 55
Primer 1BNL3992_F: CAGAAGAGGAGGAGGTGGAG
Primer 2BNL3992_R: TGCCAATGATGGAAAACTCA
PolymorphismP_ BNL3992
CommentPrimer data obtained in 2000
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr05N/AAD_chr.05153.27BNL3992View
2Guazuncho-2 x VH8-4602, BC1 (2005)Guazuncho-2 x VH8-4602, BC1 (2005).GV-BC1_chr05N/AAD_chr.05167.7BNL3992View
3Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c05N/AAD_chr.0547.34BNL3992View
4Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr05N/AAD_chr.05110BNL3992View
5Palmeri x K-101, F2 (2007)Palmeri x K-101, F2 (2007).PK-F2_chr05N/AAD_chr.05117.3BNL3992View
6AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr05N/AAD_chr.05136BNL3992View
7TM-1 x 3-79, RIL (2006)TM-1 x 3-79, RIL (2006).T3-RIL_chr.05N/AAD_chr.0565.3BNL3992View
8Xinluzao-1 x Hai-7124, F2 (2008)Xinluzao-1 x Hai-7124, F2 (2008).XH-F2_lg1/chr19N/AAD_chr.1916.6BNL3992View
9Yumian-1 x T586, F2:7 (2008)Yumian-1 x T586, RIL (2008).YT-RIL_chr05N/AAD_chr.0545.2BNL3992View
10Yumian-1 x T586, F2:3 (2005)Yumian-1 x T586, F2:3 (2005).YT-F2:3_chr05.2N/AAD_chr.0526.3BNL3992View
11CCRI-36 x Hai-7124, F2 (2007)CCRI-36 x Hai-7124, F2 (2007).CH-F2_chr05N/AAD_chr.05123.4BNL3992View
12AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr19N/AAD_chr.19245BNL3992View
13TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c05N/AAD_chr.0590.08BNL3992View
14Yumian-1 x T586, RIL (2006)YT-RIL_chr05-2N/AAD_chr.0563.7BNL3992View
15Yumian-1 x T586, RIL (2015)YT-RIL.15_chr05N/AAD_chr.0576.5BNL3992View
16TM-1 x 3-79, RIL (2014)T3-RIL.14_chr05N/AAD_chr.05112.6BNL3992View
17W10 x TM-1, F2:3 (2015)WT-F2:3_chr05-1N/AAD_chr.0544.6BNL3992View
18CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr05N/AAt.05129.3BNL3992View
19SG 747 x Giza 75, BIL (2013)SG-BIL_chr05N/AAD_chr.0591.1BNL3992View
20TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr05N/AAD_chr.05108.2BNL3992-155View
21TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr05/A5N/AAD_chr.0595.8BNL3992-155View
22Vsg x (TM-1 x Hai-7124), DH (2005)Vsg x (TM-1 x Hai-7124), DH (2005).VTH-DH.05_chr05N/AAD_chr.050BNL3992-155View
23TM-1 x Hai-7124, BC1 (2005.v0)TH-RIL_chr05N/AAD_chr.0513.1BNL3992-155View
24Yumian-1 x T586, RIL (2009)YT-RIL_chr05N/AAD_chr.0563.7BNL3992/150t(C5)View
25Yumian-1 x T586, F2:3 (2005.v0)YT-F2:3_chr05-2N/AAD_chr.0526.3BNL3992(C5)View
26TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.05N/AAD_chr.05112.58BNL3992-112.584View
27PD 94042 x (AD)4-08, F2 (2016)PA-F2_chr05N/AAt.05160.2BNL3992-160.2View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
BNL3992_FBNL3992_FGossypium hirsutumprimer
BNL3992_RBNL3992_RGossypium hirsutumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
leaf shapeqLFSP.TH-BC1_ch05.1Gossypium spp.QTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BNL3992BNL3992Gossypium hirsutummarker_locus
BNL3992-155BNL3992-155Gossypium hirsutummarker_locus
BNL3992/150t(C5)BNL3992/150t(C5)Gossypium hirsutummarker_locus
BNL3992(C5)BNL3992(C5)Gossypium hirsutummarker_locus
BNL3992BNL3992-112.584Gossypium hirsutummarker_locus
BNL3992BNL3992-160.2Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
BNL3992_origBNL3992_origGossypium hirsutumsequence_feature


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Chr09chromosomeBNL3992:2..625 .
Chr09:21481081..21481682 +
Chr9chromosomeBNL3992:2..625 .
Chr9:29926961..29927562 +
Germplasm
Stock NameType
Deltapine 90TBD
Sequence
>BNL3992 ID=BNL3992|Name=BNL3992|organism=Gossypium hirsutum|type=genetic_marker|length=155bp
CAGAAGAGGAGGAGGTGGAGGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
GAGAGAGAGAGAGAGAGAGAGAACGAAAGGAGGTGGAGTGCAAAAGCCAG
AGATGAATCAAAAAACAGAACCATCCAATCAAAGATGAGTTTTCCATCAT
TGGCA