BNL2599

Marker Overview
NameBNL2599
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 90
Source SequenceBNL2599_orig
Source Typegenomic
Repeat Motif(AG)11
PCR ConditionAnnealing temperature: 55
Primer 1BNL2599_F: ATTGCCACAACCACAATCAA
Primer 2BNL2599_R: TATTTTTTTGGGCTTGCTGA
CommentPrimer data obtained in 2000
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1MGG-293-793, MAGIC (2018)MAGIC-19831_chr01N/AAD_chr.01151.7BNL2599-151.7View
2Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr01N/AAD_chr.0181.19BNL2599View
3Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr01N/AAD_chr.01110BNL2599View
4AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr01N/AAD_chr.01174BNL2599View
5TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c01N/AAD_chr.011.63BNL2599View
6DH962 x Jinmian-6, F2 (2009)DJ-F2_chrU/LG6N/AAD_chr.unknown0.8BNL2599View
7DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr01N/AAD_chr.0129.39BNL2599View
8DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr15-1N/AAD_chr.1529.39BNL2599View
9TM-1 x 3-79, RIL (2014)T3-RIL.14_chr01N/AAD_chr.01142.7BNL2599View
10DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_chr01N/AAD_chr.0188.1BNL2599View
11DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_chr15N/AAD_chr.1588.1BNL2599View
12SG 747 x Giza 75, BIL (2013)SG-BIL_chr01-2N/AAD_chr.010BNL2599View
13TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.01N/AAD_chr.01142.74BNL2599-142.744View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
BNL2599_FBNL2599_FGossypium hirsutumprimer
BNL2599_RBNL2599_RGossypium hirsutumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
micronaireqMIC.DJiM-RIL_ch01.h08Gossypium hirsutumQTL
micronaireqMIC.DJiM-RIL_ch15.h08Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BNL2599BNL2599-151.7Gossypium hirsutummarker_locus
BNL2599BNL2599Gossypium hirsutummarker_locus
BNL2599BNL2599-142.744Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
BNL2599_origBNL2599_origGossypium hirsutumsequence_feature


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
CM017688.1chromosomeCM017688.1:2542013..2542112 -
CM017636.1chromosomeCM017636.1:2560475..2560568 -
CM017610.1chromosomeCM017610.1:3034215..3034308 -
A01chromosomeA01:2515347..2515446 -
Gbar_A01chromosomeGbar_A01:2514784..2514883 -
scaffold12265supercontigscaffold12265:258140..258239 +
A01chromosomeA01:2770391..2770492 -
A01chromosomeA01:2818425..2818524 -
A01chromosomeA01:2692765..2692866 -
Ghir_A01chromosomeGhir_A01:2815915..2816014 -
Ghir_A01chromosomeGhir_A01:21187283..21187382 -
A01chromosomeA01:2263562..2263663 -
Chr01_CRI-A2_v1.0.a1chromosomeChr01_CRI-A2_v1.0.a1:2493792..2493889 -
Chr7chromosomeChr7:107790249..107790346 -
CM018202.1chromosomeCM018202.1:2525281..2525380 -
A01chromosomeA01:3503555..3503656 -
Chr8chromosomeBNL2599:7..227 .
Chr8:61979370..61979598 +
Germplasm
Stock NameType
Deltapine 90TBD
Sequence
>BNL2599 ID=BNL2599|Name=BNL2599|organism=Gossypium hirsutum|type=genetic_marker|length=100bp
ATTGCCACAACCACAATCAAAGCAAACACATACACACACACATATATATA
TATATATATATAGGATGAAAGTCTCTTATTTCAGCAAGCCCAAAAAAATA