BNL1417

Marker Overview
NameBNL1417
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 90
Source SequenceBNL1417_orig
Source Typegenomic
Repeat Motif(AG)15
PCR ConditionAnnealing temperature: 55
Primer 1BNL1417_F: TTATTCTAACCACCGCCTCC
Primer 2BNL1417_R: TGAGTGGATATGCTTGGCCT
PolymorphismP_ BNL1417
CommentPrimer data obtained in 2000
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Guazuncho-2 x VH8-4602, BC2 (2005)Guazuncho-2 x VH8-4602, BC2 (2005).GV-BC2_chr25N/AAD_chr.2587.7BNL1417View
2Guazuncho-2 x VH8-4602, RIL (2009)Guazuncho-2 x VH8-4602, RIL (2009).GV-RIL_ch25N/AAD_chr.2544.8BNL1417View
3Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr25N/AAD_chr.2550BNL1417View
4AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr25N/AAD_chr.25137BNL1417View
5TM-1 x 3-79, RIL (2006)TM-1 x 3-79, RIL (2006).T3-RIL_chr.25N/AAD_chr.2513.7BNL1417View
6TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c25N/AAD_chr.2546.74BNL1417View
7Xinluzao-1 x Hai-7124, F2 (2008)Xinluzao-1 x Hai-7124, F2 (2008).XH-F2_lg7/chr25N/AAD_chr.25126.2BNL1417View
8Yumian-1 x T586, F2:3 (2005)Yumian-1 x T586, F2:3 (2005).YT-F2:3_chr25N/AAD_chr.250BNL1417View
9Yumian-1 x T586, F2:7 (2008)Yumian-1 x T586, RIL (2008).YT-RIL_chr25N/AAD_chr.254.5BNL1417View
10CCRI-36 x Hai-7124, F2 (2007)CCRI-36 x Hai-7124, F2 (2007).CH-F2_chr25N/AAD_chr.2593BNL1417View
11Guazuncho-2 x VH8-4602, BC1 (2005)Guazuncho-2 x VH8-4602, BC1 (2005).GV-BC1_chr25N/AAD_chr.25114.9BNL1417View
12Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c25N/AAD_chr.2591.1BNL1417View
13Yumian-1 x T586, RIL (2006)YT-RIL_chr25-2N/AAD_chr.2527BNL1417View
14Yumian-1 x T586, RIL (2015)YT-RIL.15_chr25N/AAD_chr.2588BNL1417View
15TM-1 x 3-79, RIL (2014)T3-RIL.14_chr25N/AAD_chr.2543.6BNL1417View
16TM-1 x Hai-7124, BC1 (2005.v0)TH-RIL_chr25N/AAD_chr.25264.7BNL1417-145View
17Yumian-1 x T586, RIL (2009)YT-RIL_chr25-2N/AAD_chr.2527.1BNL1417/200t(C25)View
18Yumian-1 x T586, F2:3 (2005.v0)YT-F2:3_chr25N/AAD_chr.250BNL1417(C25)View
19TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.25N/AAD_chr.2543.6BNL1417-43.6View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
BNL1417_FBNL1417_FGossypium hirsutumprimer
BNL1417_RBNL1417_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BNL1417BNL1417Gossypium hirsutummarker_locus
BNL1417-145BNL1417-145Gossypium hirsutummarker_locus
BNL1417/200t(C25)BNL1417/200t(C25)Gossypium hirsutummarker_locus
BNL1417(C25)BNL1417(C25)Gossypium hirsutummarker_locus
BNL1417BNL1417-43.6Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
BNL1417_origBNL1417_origGossypium hirsutumsequence_feature


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Chr10chromosomeBNL1417:1..238 .
Chr10:49862990..49863213 +
Chr10chromosomeBNL1417:1..238 .
Chr10:34812380..34812603 +
Germplasm
Stock NameType
Deltapine 90TBD
Sequence
>BNL1417 ID=BNL1417|Name=BNL1417|organism=Gossypium hirsutum|type=genetic_marker|length=104bp
TTATTCTAACCACCGCCTCCCTACAAAGTGAGAGAGAGAGAGAGAGAGAG
AGAGAGAGATCTAACTACCATTAATTATAACAAAAGGCCAAGCATATCCA
CTCA