BNL0830

Marker Overview
NameBNL0830
AliasBNL830
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 90
Source SequenceBNL0830_orig
Source Typegenomic
Repeat Motif(AC)10
PCR ConditionAnnealing temperature: 55
Primer 1BNL0830_F: TTCCGGGTTTTCAATAAACG
Primer 2BNL0830_R: GTTAATACTTTTTTTCTTTTGTGTGTG
PolymorphismP_ BNL0830
CommentPrimer data obtained in 2000
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Guazuncho-2 x VH8-4602, BC1 (2005)Guazuncho-2 x VH8-4602, BC1 (2005).GV-BC1_chr15N/AAD_chr.15128.7BNL830View
2Xinluzao-1 x Hai-7124, F2 (2008)Xinluzao-1 x Hai-7124, F2 (2008).XH-F2_lg20/chr15N/AAD_chr.158BNL830View
3DH962 x Jinmian-6, F2 (2009)DJ-F2_chr15N/AAD_chr.1522.1BNL830View
4DH962 x Jinmian-6, F2 (2009)DJ-F2_chr15/LG14N/AAD_chr.1522.1BNL830View
5DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr01N/AAD_chr.0154.48BNL830View
6DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr15-1N/AAD_chr.1554.48BNL830View
7TM-1 x (TX-0256 + TX-1046), CSIL (2016)TTT-CSIL_chr15N/AAD_chr.1539.1BNL830View
8DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_chr15-2N/AAD_chr.15-226.7BNL830View
9CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr15N/ADt.01109.5BNL830View
10Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c15N/AAD_chr.1591.86BNL0830View
11AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr15N/AAD_chr.15157BNL0830View
12(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr15-2N/AAD_chr.15122.3BNL0830View
13Yumian-1 x 7235, RIL (2015)Y7-RIL_chr15N/AAD_chr.1567.5BNL0830View
14HS-46 x MARCABUCAG8US-1-88, RIL (2009)HS-46 x MARCABUCAG8US-1-88, RIL (2009).HSM-RIL_chr15N/AAD_chr.1524BNL830-97View
15CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr15N/ADt.0143.21BNL0830-43.21View
16PD 94042 x (AD)4-08, F2 (2016)PA-F2_chr15N/ADt.01122.3BNL830-122.3View
Image
Images
Gel image of 288 germplasm panel sceened by SSR BNL830. Sample List: 1. Deltapine 14A, 2. Deltapine 14, 3. Short Deltapine 14, 4. Shi Duan 10, 5. Fox (CN-ZM-06131), 6. Huadong-7, 7. Ningmian-18, 8. Ningmian-21, 9. Ningmian-23, 10. Peng Hun 1, 11. Jiangsu Mian 2, 12. 57-681, 13. Dongting 3, 14. Nantong 5, 15. Ya Peng Mian, 16. Yuncheng 4, 17. Zhengzhou 385, 18. Dongting 1, 19. Yangma Big Boll, 20. Siyang-437, 21. Simian-2, 22. Su Mian 9, 23. Smooth leaf Deltapine, 24. Deltapine 16, 25. Xuzhou 538, 26. Half and Half, 27. Zhong Mian Suo 2, 28. Zhong Mian Suo 4, 29. Shan Mian 4, 30. Stonveille 4 (CN-ZM-06254), 31. Shan Mian 5, 32. China 86-1 (CN-ZM-01746), 33. Stoneville 4b (CN-ZM-06256), 34. Liao Mian 3, 35. Stoneville 2b (CN-ZM-06250), 36. Xuzhou 209, 37. 72-74, 38. Xuzhou 287, 39. Xuzhou 1818, 40. Xuzhou 142, 41. Xuzhou 142 no lint, 42. Zhong 521, 43. Zhong Mian Suo 5, 44. Zhong Mian Suo 6, 45. Uganda 4, 46. Zhong Mian Suo 7, 47. Zhong Mian Suo 12, 48. E Kang Mian 10, 49. E Mian 21, 50. Han 109, 51. Han 284, 52. Jin (Shanxi) Mian 25, 53. Lu Mian Yan 16, 54. Yu 668, 55. Yu Mian 11, 56. Yu Mian 17, 57. Yu Mian 21, 58. Zhong Mian Suo 35, 59. Zhong Mian Suo 40, 60. Jin Cou Zhong 12, 61. Zhong 12-73-12 early mature, 62. Zhong 12-73-13, 63. Zhong 12-901, 64. Zhong 12 (high-density-selection), 65. Coker 100 (CN-ZM-06166), 66. Delfos 531, 67. CN-ZM-03650, 68. Foster 6, 69. Gan Mian 1, 70. Shan Mian 3, 71. King 1, 72. Chao Yang Mian 1, 73. Guannong-1, 74. Jin Mian 2, 75. Jin Mian 1, 76. Hei Shan Mian 1, 77. Zhong Mian Suo 10, 78. KK-1543, 79. Lambright GL-5, 80. McNair 210, 81. Trice (CN-ZM-06234), 82. Yi Shu Hong, 83. P3-3594, 84. 65-3049-6, 85. 108F, 86. Bao Mian 2, 87. E Mian 9, 88. Shan Nong 3, 89. Han 74-209, 90. Han 81-272, 91. Handan 333, 92. Hong Ye Mian 2, 93. Hong Ye Mian 3, 94. Ji (Hebei) 182, 95. TM-1, 96. 3-79, 97. Lu (Shandong) Mian 12, 98. Lu Wu 401, 99. Yu Mian 17, 100. Macheng 96-1, 101. Shenmian-5, 102. Shen Mian 718 (71), 103. Shen Mian 9, 104. Shen Mian 8, 105. Xin Lu 101, 106. Xin Lu 102, 107. Zhong 1276, 108. Zhong 206, 109. Zhong Mian Suo 13, 110. Zhong 383 Glandless, 111. Zhong Mian Suo 19, 112. Zhong Mian Suo 8, 113. Ji Mian 20, 114. Ji (Hebei) A-1-7 (line33), 115. Ji (Hebei) A-7-8 (line33), 116. Chuan 109, 117. Chuan 109-1, 118. QB-1, 119. long fibre 2, 120. Ke Yuan 1, 121. Ke Yuan 4, 122. Qinli-514, 123. Shan 3619, 124. Shi Yuan 345, 125. Zhong 5881, 126. Zhong Mian Suo 23, 127. Zhong Mian Suo 9, 128. Zhong Yuan 9113, 129. E E80-11, 130. E E913, 131. E(Hubei) T 458, 132. E(Hubei) I 578, 133. CNH-67, 134. HL-07, 135. Qinyuan 91406-4, 136. Ya Huang 9101, 137. Ya Huang 9102, 138. Ya Huang 9103, 139. Zhong Yuan 9111, 140. Zhong Yuan 9112, 141. Zhong Yuan 9117, 142. Zhong Yuan 9118, 143. Zhong Yuan 9119, 144. Zhong Yuan HAS-1, 145. Zhong Yuan HST-1, 146. Zhong Yuan HST-2, 147. Zhong Yuan 9116, 148. Zhong Yuan 9115, 149. SA-1406, 150. Tashkent I, 151. Tashkent-6, 152. Zhong Yuan 9114, 153. Zhong Yuan HM-1, 154. Zhong 12, 155. Zhong 375, 156. Suyuan-3290, 157. Suyuan-7036, 158. Suyuan-7158, 159. Suyuan-7235, 160. Suyuan-7252, 161. Jin Mian 21, 162. Lang Huang F10-W99 (white lint), 163. Lang Huang F8 (brown lint), 164. Lang Mian 4, 165. Zong 1-61, 166. Zong 1-62, 167. RT White lint, 168. CN-ZM-114572, 169. Jin (Shanxi) Mian 27, 170. Ji (Hebei) Yuan 12-13, 171. Shi Yuan 638, 172. Zhong Yi B-25, 173. Zhong Yi Hong 2, 174. F(PDLINE), 175. PD 2165, 176. PD 3249, 177. AC 239, 178. AC 241, 179. Han 8957, 180. PD 109, 181. PD 113, 182. SC-1, 183. PD 6142, 184. PD 6179, 185. PD 6186, 186. PD 9223, 187. PD 9364, 188. Acala SJ-1, 189. Acala SJ-2, 190. Acala SJ-4, 191. Acala SJC-1, 192. Delcot 277-5, 193. Ji (Hebei) Yuan 23-24, 194. Ji (Hebei) Yuan 55, 195. Ji Zi 123, 196. Ji-668, 197. Jin (Shanxi) Yuan 1081, 198. Qinyuan-93089, 199. Hong Ye Mian 1, 200. Ji Mian 24 (Shi Yuan 321), 201. ISA205B396, 202. ISABC-2, 203. TX-1324, 204. TX-1326, 205. TX-1327, 206. Zhong Yuan HP-1, 207. E E901, 208. E E911, 209. Zhong Mian Suo 3, 210. Changde Small Leaf, 211. An Mian 1, 212. Xin Mian 291, 213. Liu Zhuang 1, 214. Baiquan 260, 215. Baiquan 460, 216. Baiquan 481, 217. Xiang Yang 415, 218. Xiang Yang 434, 219. Wan Mian 3, 220. Shangqiu-11, 221. Ji Han 2, 222. Ji Han 3, 223. Yan 70-14, 224. Shijiazhuang 353, 225. Ji Mian 8, 226. Lu Mian 1, 227. Lu Mian 2, 228. Liao 159, 229. He Mian 3, 230. Rendong 67-69, 231. Rendong 67-86, 232. Chang Za 1, 233. Chang Za 2, 234. Chang Za 4, 235. Yi Ke 30, 236. Yi Ke 32, 237. Hai Huang Mian, 238. Dai Hong Dai, 239. Xiang Xuan 2, 240. Zhi Mian 1, 241. Hua Mian 4, 242. Hua Mian 5, 243. Hong Shi 3, 244. E Mian 6, 245. Tian Mian 1, 246. Xiao Mian 1, 247. Xiaoxian 107, 248. Xiaoxian 171, 249. Huai Mian 3, 250. Jiangsu Mian 1, 251. Jiangsu Mian 3, 252. Ningmian-12, 253. Xuzhou 58, 254. Hu Mian 204, 255. Shanghai-1, 256. Bao Mian 13, 257. Bao Mian 18, 258. Simian-1, 259. Xin Mian 4, 260. Zhe Mian 1, 261. Ci Mian 1, 262. Bao Mian 1, 263. Gui Mian 1, 264. Gui Mian 2, 265. Autumn Deltapine, 266. Changdezaoshuxi, 267. Yun An 3, 268. Ji Han 5, 269. Xuzhou 287, 270. Pengze-1, 271. Shan-401, 272. Wu Ji Yi Zhi Hua, 273. Lishan Big Boll, 274. Xiang 4108, 275. Liao Mian 3, 276. Liao Mian 4, 277. Jin 444, 278. Jin Mian 6, 279. Jin Zhong 200, 280. Ba 11-29, 281. Chuan Jian 3, 282. Ya Peng Mian, 283. Liao (Liaoning) 7 Dominate-gland, 284. Liao (Liaoning) 7 Dominate-glandless, 285. Zhong 12 Dominate gland, 286. Zhong 12 Dominate glandless, 287. Zhong 17 (Dominate-glandless), 288. Zhong 17 Recessive glandless.
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
BNL0830_FBNL0830_FGossypium hirsutumprimer
BNL0830_RBNL0830_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BNL830BNL830Gossypium hirsutummarker_locus
BNL0830BNL0830Gossypium hirsutummarker_locus
BNL830-97BNL830-97Gossypium hirsutummarker_locus
BNL0830BNL0830-43.21Gossypium hirsutummarker_locus
BNL830BNL830-122.3Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
BNL0830_origBNL0830_origGossypium hirsutumsequence_feature


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Chr02chromosomeBNL0830:1..241 .
Chr02:11985657..11985892 +
Chr2chromosomeBNL0830:1..241 .
Chr2:39511738..39511973 +
Germplasm
Stock NameType
Deltapine 90TBD
Sequence
>BNL0830 ID=BNL0830|Name=BNL0830|organism=Gossypium hirsutum|type=genetic_marker|length=110bp
TTCCGGGTTTTCAATAAACGGATTCATTACCTTTCAAAGTTTTTGACTTT
ACACCCATCAAAATTTACAAACACACACACACACACACACAAAAGAAAAA
AAGTATTAAC