BNL0786

Marker Overview
NameBNL0786
AliasBNL786
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 90
Source SequenceBNL0786_orig
Source Typegenomic
Repeat Motif(AG)14
PCR ConditionAnnealing temperature: 55
Primer 1BNL0786_F: CTTTCCACGTGTAATTTGTTGATA
Primer 2BNL0786_R: GATCTTAACTCTTGCTCTCTCTCTCTC
PolymorphismP_ BNL0786
CommentPrimer data obtained in 2000
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
13-79 x NM24016, RIL (2008)3-79 x NM24016, RIL (2008).3N-RIL_chr15N/AAD_chr.15100.9BNL786View
27235 x TM-1, RIL (2007)7235 x TM-1, RIL (2007).7T-RIL_D01N/AAD_chr.1541.5BNL786View
3Guazuncho-2 x VH8-4602, BC1 (2005)Guazuncho-2 x VH8-4602, BC1 (2005).GV-BC1_chr15N/AAD_chr.15132.2BNL786View
4Xinluzao-1 x Hai-7124, F2 (2008)Xinluzao-1 x Hai-7124, F2 (2008).XH-F2_lg20/chr15N/AAD_chr.153.3BNL786View
5Yumian-1 x T586, F2:3 (2005)Yumian-1 x T586, F2:3 (2005).YT-F2:3_chr15.1N/AAD_chr.1533.7BNL786View
6CCRI-36 x Hai-7124, F2 (2007)CCRI-36 x Hai-7124, F2 (2007).CH-F2_chr15N/AAD_chr.15125.1BNL786View
77235 x TM-1, F2:3 (2005)7T-F2:3_chr15N/AAD_chr.1572.9BNL786View
8W10 x TM-1, F2:3 (2015)WT-F2:3_chr15N/AAD_chr.1511.1BNL786View
9CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr15N/ADt.01111.4BNL786View
10Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c15N/AAD_chr.1589.5BNL0786View
11Guazuncho-2 x VH8-4602, RIL (2009)Guazuncho-2 x VH8-4602, RIL (2009).GV-RIL_ch15N/AAD_chr.1553.92BNL0786View
12TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c15N/AAD_chr.1545.15BNL0786View
13AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr15N/AAD_chr.15149BNL0786View
14TM-1 x 3-79, RIL (2006)TM-1 x 3-79, RIL (2006).T3-RIL_chr.15bN/AAD_chr.1527.8BNL0786View
15Yumian-1 x T586, RIL (2006)YT-RIL_chr15-3N/AAD_chr.1513.5BNL0786View
16Yumian-1 x T586, RIL (2015)YT-RIL.15_chr15N/AAD_chr.1540.7BNL0786View
17TM-1 x 3-79, RIL (2014)T3-RIL.14_chr15N/AAD_chr.1574.7BNL0786View
18SG 747 x Giza 75, BIL (2013)SG-BIL_chr15N/AAD_chr.1532.5BNL0786View
19Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr15N/AAD_chr.1570BNL0786bView
20TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr15N/AAD_chr.1543.4BNL786-120View
21TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr15/D1N/AAD_chr.1541.82BNL786-120View
22Vsg x (TM-1 x Hai-7124), DH (2005)Vsg x (TM-1 x Hai-7124), DH (2005).VTH-DH.05_chr15.2N/AAD_chr.1526.8BNL786-120View
23Yumian-1 x T586, RIL (2009)YT-RIL_chr15-1N/AAD_chr.1513.5BNL0786/110y(C15)View
24Yumian-1 x T586, F2:3 (2005.v0)YT-F2:3_chr15-1N/AAD_chr.1533.7BNL786(C15)View
25CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr15N/ADt.0139.99BNL0786-39.986View
26TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.15N/AAD_chr.1574.74BNL0786-74.741View
27PD 94042 x (AD)4-08, F2 (2016)PA-F2_chr15N/ADt.01103.1BNL786-103.1View
Image
Images
Gel image of 288 germplasm panel sceened by SSR BNL786. Sample List: 1. Deltapine 14A, 2. Deltapine 14, 3. Short Deltapine 14, 4. Shi Duan 10, 5. Fox (CN-ZM-06131), 6. Huadong-7, 7. Ningmian-18, 8. Ningmian-21, 9. Ningmian-23, 10. Peng Hun 1, 11. Jiangsu Mian 2, 12. 57-681, 13. Dongting 3, 14. Nantong 5, 15. Ya Peng Mian, 16. Yuncheng 4, 17. Zhengzhou 385, 18. Dongting 1, 19. Yangma Big Boll, 20. Siyang-437, 21. Simian-2, 22. Su Mian 9, 23. Smooth leaf Deltapine, 24. Deltapine 16, 25. Xuzhou 538, 26. Half and Half, 27. Zhong Mian Suo 2, 28. Zhong Mian Suo 4, 29. Shan Mian 4, 30. Stonveille 4 (CN-ZM-06254), 31. Shan Mian 5, 32. China 86-1 (CN-ZM-01746), 33. Stoneville 4b (CN-ZM-06256), 34. Liao Mian 3, 35. Stoneville 2b (CN-ZM-06250), 36. Xuzhou 209, 37. 72-74, 38. Xuzhou 287, 39. Xuzhou 1818, 40. Xuzhou 142, 41. Xuzhou 142 no lint, 42. Zhong 521, 43. Zhong Mian Suo 5, 44. Zhong Mian Suo 6, 45. Uganda 4, 46. Zhong Mian Suo 7, 47. Zhong Mian Suo 12, 48. E Kang Mian 10, 49. E Mian 21, 50. Han 109, 51. Han 284, 52. Jin (Shanxi) Mian 25, 53. Lu Mian Yan 16, 54. Yu 668, 55. Yu Mian 11, 56. Yu Mian 17, 57. Yu Mian 21, 58. Zhong Mian Suo 35, 59. Zhong Mian Suo 40, 60. Jin Cou Zhong 12, 61. Zhong 12-73-12 early mature, 62. Zhong 12-73-13, 63. Zhong 12-901, 64. Zhong 12 (high-density-selection), 65. Coker 100 (CN-ZM-06166), 66. Delfos 531, 67. CN-ZM-03650, 68. Foster 6, 69. Gan Mian 1, 70. Shan Mian 3, 71. King 1, 72. Chao Yang Mian 1, 73. Guannong-1, 74. Jin Mian 2, 75. Jin Mian 1, 76. Hei Shan Mian 1, 77. Zhong Mian Suo 10, 78. KK-1543, 79. Lambright GL-5, 80. McNair 210, 81. Trice (CN-ZM-06234), 82. Yi Shu Hong, 83. P3-3594, 84. 65-3049-6, 85. 108F, 86. Bao Mian 2, 87. E Mian 9, 88. Shan Nong 3, 89. Han 74-209, 90. Han 81-272, 91. Handan 333, 92. Hong Ye Mian 2, 93. Hong Ye Mian 3, 94. Ji (Hebei) 182, 95. TM-1, 96. 3-79, 97. Lu (Shandong) Mian 12, 98. Lu Wu 401, 99. Yu Mian 17, 100. Macheng 96-1, 101. Shenmian-5, 102. Shen Mian 718 (71), 103. Shen Mian 9, 104. Shen Mian 8, 105. Xin Lu 101, 106. Xin Lu 102, 107. Zhong 1276, 108. Zhong 206, 109. Zhong Mian Suo 13, 110. Zhong 383 Glandless, 111. Zhong Mian Suo 19, 112. Zhong Mian Suo 8, 113. Ji Mian 20, 114. Ji (Hebei) A-1-7 (line33), 115. Ji (Hebei) A-7-8 (line33), 116. Chuan 109, 117. Chuan 109-1, 118. QB-1, 119. long fibre 2, 120. Ke Yuan 1, 121. Ke Yuan 4, 122. Qinli-514, 123. Shan 3619, 124. Shi Yuan 345, 125. Zhong 5881, 126. Zhong Mian Suo 23, 127. Zhong Mian Suo 9, 128. Zhong Yuan 9113, 129. E E80-11, 130. E E913, 131. E(Hubei) T 458, 132. E(Hubei) I 578, 133. CNH-67, 134. HL-07, 135. Qinyuan 91406-4, 136. Ya Huang 9101, 137. Ya Huang 9102, 138. Ya Huang 9103, 139. Zhong Yuan 9111, 140. Zhong Yuan 9112, 141. Zhong Yuan 9117, 142. Zhong Yuan 9118, 143. Zhong Yuan 9119, 144. Zhong Yuan HAS-1, 145. Zhong Yuan HST-1, 146. Zhong Yuan HST-2, 147. Zhong Yuan 9116, 148. Zhong Yuan 9115, 149. SA-1406, 150. Tashkent I, 151. Tashkent-6, 152. Zhong Yuan 9114, 153. Zhong Yuan HM-1, 154. Zhong 12, 155. Zhong 375, 156. Suyuan-3290, 157. Suyuan-7036, 158. Suyuan-7158, 159. Suyuan-7235, 160. Suyuan-7252, 161. Jin Mian 21, 162. Lang Huang F10-W99 (white lint), 163. Lang Huang F8 (brown lint), 164. Lang Mian 4, 165. Zong 1-61, 166. Zong 1-62, 167. RT White lint, 168. CN-ZM-114572, 169. Jin (Shanxi) Mian 27, 170. Ji (Hebei) Yuan 12-13, 171. Shi Yuan 638, 172. Zhong Yi B-25, 173. Zhong Yi Hong 2, 174. F(PDLINE), 175. PD 2165, 176. PD 3249, 177. AC 239, 178. AC 241, 179. Han 8957, 180. PD 109, 181. PD 113, 182. SC-1, 183. PD 6142, 184. PD 6179, 185. PD 6186, 186. PD 9223, 187. PD 9364, 188. Acala SJ-1, 189. Acala SJ-2, 190. Acala SJ-4, 191. Acala SJC-1, 192. Delcot 277-5, 193. Ji (Hebei) Yuan 23-24, 194. Ji (Hebei) Yuan 55, 195. Ji Zi 123, 196. Ji-668, 197. Jin (Shanxi) Yuan 1081, 198. Qinyuan-93089, 199. Hong Ye Mian 1, 200. Ji Mian 24 (Shi Yuan 321), 201. ISA205B396, 202. ISABC-2, 203. TX-1324, 204. TX-1326, 205. TX-1327, 206. Zhong Yuan HP-1, 207. E E901, 208. E E911, 209. Zhong Mian Suo 3, 210. Changde Small Leaf, 211. An Mian 1, 212. Xin Mian 291, 213. Liu Zhuang 1, 214. Baiquan 260, 215. Baiquan 460, 216. Baiquan 481, 217. Xiang Yang 415, 218. Xiang Yang 434, 219. Wan Mian 3, 220. Shangqiu-11, 221. Ji Han 2, 222. Ji Han 3, 223. Yan 70-14, 224. Shijiazhuang 353, 225. Ji Mian 8, 226. Lu Mian 1, 227. Lu Mian 2, 228. Liao 159, 229. He Mian 3, 230. Rendong 67-69, 231. Rendong 67-86, 232. Chang Za 1, 233. Chang Za 2, 234. Chang Za 4, 235. Yi Ke 30, 236. Yi Ke 32, 237. Hai Huang Mian, 238. Dai Hong Dai, 239. Xiang Xuan 2, 240. Zhi Mian 1, 241. Hua Mian 4, 242. Hua Mian 5, 243. Hong Shi 3, 244. E Mian 6, 245. Tian Mian 1, 246. Xiao Mian 1, 247. Xiaoxian 107, 248. Xiaoxian 171, 249. Huai Mian 3, 250. Jiangsu Mian 1, 251. Jiangsu Mian 3, 252. Ningmian-12, 253. Xuzhou 58, 254. Hu Mian 204, 255. Shanghai-1, 256. Bao Mian 13, 257. Bao Mian 18, 258. Simian-1, 259. Xin Mian 4, 260. Zhe Mian 1, 261. Ci Mian 1, 262. Bao Mian 1, 263. Gui Mian 1, 264. Gui Mian 2, 265. Autumn Deltapine, 266. Changdezaoshuxi, 267. Yun An 3, 268. Ji Han 5, 269. Xuzhou 287, 270. Pengze-1, 271. Shan-401, 272. Wu Ji Yi Zhi Hua, 273. Lishan Big Boll, 274. Xiang 4108, 275. Liao Mian 3, 276. Liao Mian 4, 277. Jin 444, 278. Jin Mian 6, 279. Jin Zhong 200, 280. Ba 11-29, 281. Chuan Jian 3, 282. Ya Peng Mian, 283. Liao (Liaoning) 7 Dominate-gland, 284. Liao (Liaoning) 7 Dominate-glandless, 285. Zhong 12 Dominate gland, 286. Zhong 12 Dominate glandless, 287. Zhong 17 (Dominate-glandless), 288. Zhong 17 Recessive glandless.
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
BNL0786_FBNL0786_FGossypium hirsutumprimer
BNL0786_RBNL0786_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BNL786BNL786Gossypium hirsutummarker_locus
BNL0786BNL0786Gossypium hirsutummarker_locus
BNL0786bBNL0786bGossypium hirsutummarker_locus
BNL786-120BNL786-120Gossypium hirsutummarker_locus
BNL0786/110y(C15)BNL0786/110y(C15)Gossypium hirsutummarker_locus
BNL786(C15)BNL786(C15)Gossypium hirsutummarker_locus
BNL0786BNL0786-39.986Gossypium hirsutummarker_locus
BNL0786BNL0786-74.741Gossypium hirsutummarker_locus
BNL786BNL786-103.1Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
BNL0786_origBNL0786_origGossypium hirsutumsequence_feature


Germplasm
Stock NameType
Deltapine 90TBD
Sequence
>BNL0786 ID=BNL0786|Name=BNL0786|organism=Gossypium hirsutum|type=genetic_marker|length=121bp
CTTTCCACGTGTAATTTGTTGATAAAGCCACGTGGTATTCCCATTGGATA
CCTTTGGAAACCGGTCTAAAATAATGCAAAGAGAGAGAGAGAGAGAGAGA
GAGAGAGCAAGAGTTAAGATC