BNL0663

Marker Overview
NameBNL0663
AliasBNL663
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 90
Source SequenceBNL0663_orig
Source Typegenomic
Repeat Motif(AG)12
PCR ConditionAnnealing temperature: 55
Primer 1BNL0663_F: GGGGGGAAATGAACAGATTT
Primer 2BNL0663_R: GAAGATATCCCCGCCTTCTC
CommentPrimer data obtained in 2000
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1CCRI-36 x Hai-7124, F2 (2007)CCRI-36 x Hai-7124, F2 (2007).CH-F2_chr02N/AAD_chr.0211.1BNL663View
2Handan-208 x Pima-90, F2:3 (2007)Handan-208 x Pima-90, F2:3 (2007).HP-F2:3_chr08/lgA02N/AAD_chr.08266.6BNL663View
3Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr02N/AAD_chr.02116.12BNL663View
4DH962 x Jinmian-6, F2 (2009)DJ-F2_chr02N/AAD_chr.020BNL663View
5DH962 x Jinmian-6, F2 (2009)DJ-F2_chr02/LG48N/AAD_chr.020BNL663View
6DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr02-1N/AAD_chr.0213.48BNL663View
7DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_chr02-1N/AAD_chr.02-10BNL663View
8Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr02N/AAD_chr.0210BNL0663aView
9AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr02N/AAD_chr.0215bnl0663View
10TM-1 x 3-79, RIL (2006)TM-1 x 3-79, RIL (2006).T3-RIL_chr.2bN/AAD_chr.020bnl0663View
11TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c02N/AAD_chr.0216.6bnl0663View
12TM-1 x 3-79, RIL (2014)T3-RIL.14_chr02N/AAD_chr.0211.2bnl0663View
130-153 x sGK9708, RIL (2016)0s-RIL_chr02-3N/AAD_chr.0223.7bnl0663View
14SG 747 x Giza 75, BIL (2013)SG-BIL_chr02N/AAD_chr.027.7bnl0663View
15TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.02N/AAD_chr.0211.21BNL0663-11.211View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
BNL0663_FBNL0663_FGossypium hirsutumprimer
BNL0663_RBNL0663_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BNL663BNL663Gossypium hirsutummarker_locus
BNL0663aBNL0663aGossypium hirsutummarker_locus
bnl0663bnl0663Gossypium hirsutummarker_locus
BNL0663BNL0663-11.211Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
BNL0663_origBNL0663_origGossypium hirsutumsequence_feature


Germplasm
Stock NameType
Deltapine 90TBD
Sequence
>BNL0663 ID=BNL0663|Name=BNL0663|organism=Gossypium hirsutum|type=genetic_marker|length=137bp
GGGGGGAAATGAACAGATTTTGTGCTGAGAAGCGAGAAAGTGAAGAAGAT
TACGAGTCTATGAAAGCGTCATTCAATTCACGCGAGGCAGAGAGAAAGAG
AGAGAGAGAGAGAGAGAGAGAAGGCGGGGATATCTTC