BNL0625

Marker Overview
NameBNL0625
AliasBNL625
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 90
Source SequenceBNL0625_orig
Source Typegenomic
Repeat Motif(AG)14
PCR ConditionAnnealing temperature: 55
Primer 1BNL0625_F: AGAGAGGGGGGAAAAGTTCA
Primer 2BNL0625_R: GCCAGGCATGGTTTCTATGT
PolymorphismP_ BNL0625
CommentPrimer data obtained in 2000
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1CCRI-36 x Hai-7124, F2 (2007)CCRI-36 x Hai-7124, F2 (2007).CH-F2_A03N/AAD_chr.11119.3BNL625View
2Guazuncho-2 x VH8-4602, BC1 (2005)Guazuncho-2 x VH8-4602, BC1 (2005).GV-BC1_chr11/lgA03N/AAD_chr.11100.1BNL625View
3Handan-208 x Pima-90, F2:3 (2007)Handan-208 x Pima-90, F2:3 (2007).HP-F2:3_chr04N/AAD_chr.04105.1BNL625View
4Yumian-1 x T586, F2:3 (2005)Yumian-1 x T586, F2:3 (2005).YT-F2:3_UncertainN/AAD_unknown19.6BNL625View
5Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr11N/AAD_chr.1198.33BNL625View
6CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr11N/AAt.11139.5BNL625View
7Deltapine-61 x Texas-701, F2 (2007)Deltapine-61 x Texas-701, F2 (2007).DT-F2_chr.11N/AAD_chr.110.6BNL625-234View
8Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c11N/AAD_chr.1186.77BNL0625View
9Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr11N/AAD_chr.11110BNL0625View
10AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr11N/AAD_chr.1172BNL0625View
11AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr04N/AAD_chr.04142BNL0625View
12TM-1 x 3-79, RIL (2006)TM-1 x 3-79, RIL (2006).T3-RIL_chr.11bN/AAD_chr.1178.8BNL0625View
13Yumian-1 x T586, F2:7 (2008)Yumian-1 x T586, RIL (2008).YT-RIL_chr11.2N/AAD_chr.110BNL0625View
14AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr12N/AAD_chr.1277BNL0625View
15TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c11N/AAD_chr.1199.78BNL0625View
16Yumian-1 x T586, RIL (2006)YT-RIL_chr11-3N/AAD_chr.1155.7BNL0625View
17Yumian-1 x T586, RIL (2015)YT-RIL.15_chr11N/AAD_chr.1176.5BNL0625View
18TM-1 x 3-79, RIL (2014)T3-RIL.14_chr11N/AAD_chr.11102.5BNL0625View
19Palmeri x K-101, F2 (2007)Palmeri x K-101, F2 (2007).PK-F2_chr11/lgA03N/AAD_chr.1169.4BNL625bView
20Palmeri x K-101, F2 (2007)Palmeri x K-101, F2 (2007).PK-F2_chr12N/AAD_chr.1283.8BNL625aView
21TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr11N/AAD_chr.1175.1BNL625-205View
22TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr11/A11N/AAD_chr.1173.56BNL625-205View
23TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr11N/AAD_chr.1180.3BNL625-185View
24TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr11/A11N/AAD_chr.1180.68BNL625-185View
25Vsg x (TM-1 x Hai-7124), DH (2005)Vsg x (TM-1 x Hai-7124), DH (2005).VTH-DH.05_lgD08.3N/AAD_chr.1947.5BNL625-235View
26Yumian-1 x T586, RIL (2009)YT-RIL_chr11-2N/AAD_chr.1155.1BNL0625/120t(C11)View
27Yumian-1 x T586, F2:3 (2005.v0)YT-F2:3_chrUncertainN/AAD_chr.unknown19.6BNL625(C12)View
28TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.11N/AAD_chr.11102.45BNL0625-102.454View
29PD 94042 x (AD)4-08, F2 (2016)PA-F2_chr11N/AAt.11119.4BNL625-119.4View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
BNL0625_FBNL0625_FGossypium hirsutumprimer
BNL0625_RBNL0625_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BNL625BNL625Gossypium hirsutummarker_locus
BNL625-234BNL625-234Gossypium hirsutummarker_locus
BNL0625BNL0625Gossypium hirsutummarker_locus
BNL625bBNL625bGossypium hirsutummarker_locus
BNL625aBNL625aGossypium hirsutummarker_locus
BNL625-205BNL625-205Gossypium hirsutummarker_locus
BNL625-185BNL625-185Gossypium hirsutummarker_locus
BNL625-235BNL625-235Gossypium hirsutummarker_locus
BNL0625/120t(C11)BNL0625/120t(C11)Gossypium hirsutummarker_locus
BNL625(C12)BNL625(C12)Gossypium hirsutummarker_locus
BNL0625BNL0625-102.454Gossypium hirsutummarker_locus
BNL625BNL625-119.4Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
BNL0625_origBNL0625_origGossypium hirsutumsequence_feature


Germplasm
Stock NameType
Deltapine 90TBD
Sequence
>BNL0625 ID=BNL0625|Name=BNL0625|organism=Gossypium hirsutum|type=genetic_marker|length=244bp
AGAGAGGGGGGAAAAGTTCAAATGNTTTAAAAGAGAGAGAGAGAGAGAGA
GAGAGAGAGAAGACATATNNCCAATAACTAAACTGAAAGCTTGAAAGAAT
CGCCTTTTGAGTTTATAGCAAAAGCAGTCATCCCAAAAATCCTAGGAAGA
TTAGATACACCAACTTCTAACAAGCGATGATAGAATTCCTATAACAAAAA
AAATTCCTCAAACAATATGACAAAACATAGAAACCATGCCTGGC