BNL0569

Marker Overview
NameBNL0569
AliasBNL569
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 90
Source SequenceBNL0569_orig
Source Typegenomic
Repeat Motif(AG)20
PCR ConditionAnnealing temperature: 55
Primer 1BNL0569_F: TTGAGAAGTACTACCATTAATTATCCA
Primer 2BNL0569_R: GACTGATGCCAGTTGACCCT
PolymorphismP_ BNL0569
CommentPrimer data obtained in 2000
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr13N/AAD_chr.1392.6BNL569aView
2Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr18N/AAD_chr.1872.86BNL569bView
3Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr13N/AAD_chr.1370BNL0569aView
4TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c18N/AAD_chr.1860.36BNL0569aView
5TM-1 x 3-79, RIL (2014)T3-RIL.14_chr18N/AAD_chr.1861.3BNL0569aView
6Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr18N/AAD_chr.1870BNL0569bView
7TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c13N/AAD_chr.1388.63BNL0569bView
8TM-1 x 3-79, RIL (2014)T3-RIL.14_chr13N/AAD_chr.1385BNL0569bView
9AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr18N/AAD_chr.1836bnl0569View
10AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr13N/AAD_chr.1375bnl0569View
11Yumian-1 x 7235, RIL (2015)Y7-RIL_chr13N/AAD_chr.133.3bnl0569View
12SG 747 x Giza 75, BIL (2013)SG-BIL_chr18N/AAD_chr.18145.9bnl0569View
13GB713 x Nem-X, F2 (2011)GN-F2_chr18N/AAD_chr.1842.8BNL569_131View
14GX1135 x GX100-2, F2 (2013)GG-F2_chr13N/AAD_chr.1358.1BNL569View
15TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.13N/AAD_chr.1385BNL0569b-84.997View
16TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.18N/AAD_chr.1861.33BNL0569a-61.331View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
BNL0569_FBNL0569_FGossypium hirsutumprimer
BNL0569_RBNL0569_RGossypium hirsutumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
seed cotton weight per bollqBWT.SG-BIL_ch18.aksu07.2Gossypium hirsutum x barbadenseQTL
lint yieldqLY.SG-BIL_ch18.aksu07Gossypium hirsutum x barbadenseQTL
micronaireqMIC.SG-BIL_ch18.ay07Gossypium hirsutum x barbadenseQTL
seed cotton yieldqSCY.SG-BIL_ch18.aksu07Gossypium hirsutum x barbadenseQTL


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
2.5 span lengthqSL2.5.TSP-BNL0569Gossypium spp.QTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BNL569aBNL569aGossypium hirsutummarker_locus
BNL569bBNL569bGossypium hirsutummarker_locus
BNL0569aBNL0569aGossypium hirsutummarker_locus
BNL0569bBNL0569bGossypium hirsutummarker_locus
bnl0569bnl0569Gossypium hirsutummarker_locus
BNL569_131BNL569_131Gossypium hirsutummarker_locus
BNL569BNL569Gossypium hirsutummarker_locus
BNL0569bBNL0569b-84.997Gossypium hirsutummarker_locus
BNL0569aBNL0569a-61.331Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
BNL0569_origBNL0569_origGossypium hirsutumsequence_feature


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
CM017700.1chromosomeCM017700.1:98490355..98490486 +
CM017648.1chromosomeCM017648.1:103217786..103217926 +
CM017661.1chromosomeCM017661.1:53810913..53811079 +
CM017622.1chromosomeCM017622.1:98106436..98106582 +
CM017635.1chromosomeCM017635.1:50524095..50524242 +
A13chromosomeA13:100703094..100703256 +
D13chromosomeD13:50883072..50883207 +
Gbar_A13chromosomeGbar_A13:97244400..97244553 +
Gbar_D13chromosomeGbar_D13:49513619..49513754 +
scaffold15155supercontigscaffold15155:43920..44201 +
Dt13chromosomeDt13:52265848..52266129 +
A13chromosomeA13:94948005..94948151 +
D13chromosomeD13:49919069..49919208 +
D13chromosomeD13:52993332..52993466 +
A13chromosomeA13:98709667..98709813 +
D13chromosomeD13:53944712..53944851 +
Ghir_A13chromosomeGhir_A13:96026268..96026405 +
Ghir_D13chromosomeGhir_D13:52827611..52827748 +
A13chromosomeA13:68739707..68739853 +
D13chromosomeD13:49649502..49649641 +
Dt_chr13chromosomeDt_chr13:19531674..19531813 -
Dt_chr7chromosomeDt_chr7:20418725..20418873 +
D10_13chromosomeD10_13:50618792..50618945 +
scaffold485supercontigscaffold485:103303..103434 -
Chr13_CRI-A2_v1.0.a1chromosomeChr13_CRI-A2_v1.0.a1:110725797..110725936 +
Chr13chromosomeChr13:57120964..57121105 +
D5_13chromosomeD5_13:48443235..48443366 +
CM018214.1chromosomeCM018214.1:96475310..96475474 +
CM018227.1chromosomeCM018227.1:49836454..49836589 +
D13chromosomeD13:53862559..53862698 +
Chr13chromosomeBNL0569:1..228 .
Chr13:47353483..47353704 +
scaffold485supercontigBNL0569:1..228 .
scaffold485:103218..103437 -
Germplasm
Stock NameType
Deltapine 90TBD
Sequence
>BNL0569 ID=BNL0569|Name=BNL0569|organism=Gossypium hirsutum|type=genetic_marker|length=140bp
TTGAGAAGTACTACCATTAATTATCCAAAAATAAGAAAAAAAGGAAGAGA
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGACAGGTGCCACCATT
CTAAATCTTTTTATTTCTCCAGGGTCAACTGGCATCAGTC