BNL0500

Marker Overview
NameBNL0500
AliasBNL500
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 90
Source SequenceBNL0500_orig
Source Typegenomic
Repeat Motif(GA)11
PCR ConditionAnnealing temperature: 55
Primer 1BNL0500_F: TACAAAGCCAGGTCAAAGGG
Primer 2BNL0500_R: TGGTCATTGGAAGCAGATGA
CommentPrimer data obtained in 2000
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr24N/AAD_chr.2490BNL0500View
2(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr24N/AAD_chr.2447.7BNL0500View
3Yumian-1 x 7235, RIL (2015)Y7-RIL_chr24N/AAD_chr.2431.5BNL0500View
4Xinluzao-1 x Hai-7124, F2 (2008)Xinluzao-1 x Hai-7124, F2 (2008).XH-F2_lg3/chr24N/AAD_chr.24117.5BNL500View
5DH962 x Jinmian-6, F2 (2009)DJ-F2_chrU/LG19N/AAD_chr.unknown40.7BNL500View
6DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr24-1N/AAD_chr.2437.95BNL500View
7DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_chr24-2N/AAD_chr.24-26.7BNL500View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
BNL0500_FBNL0500_FGossypium hirsutumprimer
BNL0500_RBNL0500_RGossypium hirsutumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
boll numberqBN.DJiM-RIL_ch24-2.h11Gossypium hirsutumQTL
fiber lengthqFL.DJiM-RIL_ch24-2.hj08-13Gossypium hirsutumQTL
fiber uniformityqFU.DJiM-RIL_ch24-2.h13Gossypium hirsutumQTL
lint yieldqLY.DJiM-RIL_ch24-2.h11.1Gossypium hirsutumQTL
lint yieldqLY.DJiM-RIL_ch24-2.hj08-13Gossypium hirsutumQTL
micronaireqMIC.DJiM-RIL_ch24-2.h11Gossypium hirsutumQTL
micronaireqMIC.DJiM-RIL_ch24-2.hj08-13Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BNL0500BNL0500Gossypium hirsutummarker_locus
BNL500BNL500Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
BNL0500_origBNL0500_origGossypium hirsutumsequence_feature


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Chr04chromosomeBNL0500:1..312 .
Chr04:40898605..40898911 +
scaffold202supercontigBNL0500:1..312 .
scaffold202:955490..955796 -
Germplasm
Stock NameType
Deltapine 90TBD
Sequence
>BNL0500 ID=BNL0500|Name=BNL0500|organism=Gossypium hirsutum|type=genetic_marker|length=106bp
TACAAAGCCAGGTCAAAGGGTTAGAAAAAAAAAAGCGAGAGAGAGAGAGA
GAGAGAGAACTTGGTAGTCAAAACTATGGAACTTGTTCATCTGCTTCCAA
TGACCA