HAU2605_F

Overview
NameHAU2605_F
Unique NameHAU2605_F
Typeprimer
OrganismGossypium spp. (Cotton)
Sequences
The following sequences are available for this feature:

primer sequence

>HAU2605_F ID=HAU2605_F|Name=HAU2605_F|organism=Gossypium spp.|type=primer|length=20bp
TGACGATCATACCCGCCCCA
back to top
Relationships

The following genetic_marker feature(s) are adjacent to this primer:

Feature NameUnique NameSpeciesType
HAU2605HAU2605Gossypium spp.genetic_marker