DPL0897_F

Overview
NameDPL0897_F
Unique NameDPL0897_F
Typeprimer
OrganismGossypium hirsutum (Upland Cotton)
Sequences
The following sequences are available for this feature:

primer sequence

>DPL0897_F ID=DPL0897_F|Name=DPL0897_F|organism=Gossypium hirsutum|type=primer|length=20bp
ATCGTACCCAATGGAGGATG
back to top
Relationships

The following genetic_marker feature(s) are adjacent to this primer:

Feature NameUnique NameSpeciesType
DPL0897DPL0897Gossypium hirsutumgenetic_marker