SWU07-208

Marker Overview
NameSWU07-208
Genbank IDCB066521
TypeSSR
SpeciesGossypium spp.
Repeat Motif(AC)3
Primer 1SWU07-208_F: CGACCCTTGAAGTTTGATTT
Primer 2SWU07-208_R: TGTGGTGAACGAGGATTATTT
Product Length105
Publication[view all]
Commentmarker sequence confirmed
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr15N/AAD_chr.1588.4SWU07-208View
2CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr15N/ADt.0185.58SWU07-208-85.584View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
SWU07-208_RSWU07-208.SWU07-208_RGossypium spp.primer
SWU07-208_FSWU07-208.SWU07-208_FGossypium spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SWU07-208SWU07-208Gossypium spp.marker_locus
SWU07-208SWU07-208-85.584Gossypium spp.marker_locus


References
External references for this genetic_marker
DatabaseAccession
DB:genbankCB066521
Sequence
>SWU07-208 ID=SWU07-208|Name=SWU07-208|organism=Gossypium spp.|type=genetic_marker|length=105bp
CGACCCTTGAAGTTTGATTTCACCAGGGATGGCCTCAAAGTCACTACCCG
TTTCTTTGGCCCAACACACCCCCCTTTGATCACCAAATAATCCTCGTTCA
CCACA