SWU06-122

Marker Overview
NameSWU06-122
Genbank IDCA994151
TypeSSR
SpeciesGossypium herbaceum
Repeat Motif(GAT)3
Primer 1SWU06-122_F: CAGCATACTAATGGCAAGG
Primer 2SWU06-122_R: TCATGGGAAGGCAGAAAC
Product Length250
Publication[view all]
Commentmarker sequence confirmed
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Yumian-1 x T586, RIL (2015)YT-RIL.15_chr06N/AAD_chr.06150.3SWU06-122View
2Yumian-1 x 7235, RIL (2015)Y7-RIL_chr06N/AAD_chr.0686SWU06-122View
3CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr06N/AAD_chr.0656.5SWU06-122View
4CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr25N/ADt.06108.33SWU06-122-108.328View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
SWU06-122_FSWU06-122.SWU06-122_FGossypium herbaceumprimer
SWU06-122_RSWU06-122.SWU06-122_RGossypium herbaceumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SWU06-122SWU06-122Gossypium herbaceummarker_locus
SWU06-122SWU06-122-108.328Gossypium herbaceummarker_locus


References
External references for this genetic_marker
DatabaseAccession
DB:genbankCA994151
Sequence
>SWU06-122 ID=SWU06-122|Name=SWU06-122|organism=Gossypium herbaceum|type=genetic_marker|length=250bp
CAGCATACTAATGGCAAGGGCCATTTTGTTGTCGATGAGAGTAATTCACT
CCCAGTTGGGTATCACTCAGGAGGAGTTAATAATGATCTAGGTTTTGAGG
AAAAAAATAAGCAAATGGATGTGCAAACAGATGATGATAAGAGGAAGATA
AAATCAAGGTGCGGTGAGACCTATATGCCTTTTATAACATAGAATGAATT
TAAGCTCTTTATTATGTACTTTTTGCCAGCAAGTTTCTGCCTTCCCATGA