SWU06-120

Marker Overview
NameSWU06-120
Genbank IDCB066565
TypeSSR
SpeciesGossypium spp.
Repeat Motif(AG)3,(ATC)3
Primer 1SWU06-120_F: TCCGAACAATAGCAGCAT
Primer 2SWU06-120_R: GGGAGGGAGGTGGAAGAT
Product Length175
Publication[view all]
Commentmarker sequence confirmed
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Yumian-1 x T586, RIL (2015)YT-RIL.15_chr06N/AAD_chr.06143.6SWU06-120View
2Yumian-1 x 7235, RIL (2015)Y7-RIL_chr06N/AAD_chr.06107.3SWU06-120View
3CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr06N/AAD_chr.0652.8SWU06-120View
4CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr25N/ADt.06106.28SWU06-120-106.279View
Relationships

This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
seed palmitic acid contentqFAPAL.YT-RIL_ch06.cq07Gossypium hirsutumQTL


This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
SWU06-120_FSWU06-120.SWU06-120_FGossypium spp.primer
SWU06-120_RSWU06-120.SWU06-120_RGossypium spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SWU06-120SWU06-120Gossypium spp.marker_locus
SWU06-120SWU06-120-106.279Gossypium spp.marker_locus


References
External references for this genetic_marker
DatabaseAccession
DB:genbankCB066565
Sequence
>SWU06-120 ID=SWU06-120|Name=SWU06-120|organism=Gossypium spp.|type=genetic_marker|length=175bp
TCCGAACAATAGCAGCATCGACCTGATATTGACGGTCTTGAAATACTCTT
TCGGTAGTGCTCGTGTTTTCCTCCACTGTCTCTTTCATCTGGATTGCGTT
TACCTTTATACGATAGAGAGGAGCAGAAAATCCTTCATTGAAAACGAAAG
AATCATCATCTTCCACCTCCCTCCC