SWU00950

Marker Overview
NameSWU00950
AliasSWU0950
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
Repeat Motif(CAAACT)3
Primer 1SWU00950_F: GGAGTCTTGGTGGGCTTA
Primer 2SWU00950_R: AAGTGTAGGCGGCATTGT
Product Length130
Publication[view all]
Commentmarker sequence confirmed
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Yumian-1 x T586, RIL (2015)YT-RIL.15_chr20N/AAD_chr.20133.8SWU00950View
2Yumian-1 x 7235, RIL (2015)Y7-RIL_chr20N/AAD_chr.20127.9SWU0950View
3CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr20N/AAD_chr.2043.5SWU0950View
4CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr01N/AAt.0110.05SWU00950-10.052View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
SWU00950_RSWU00950.SWU00950_RGossypium hirsutumprimer
SWU00950_FSWU00950.SWU00950_FGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SWU00950SWU00950Gossypium hirsutummarker_locus
SWU0950SWU0950Gossypium hirsutummarker_locus
SWU00950SWU00950-10.052Gossypium hirsutummarker_locus


Sequence
>SWU00950 ID=SWU00950|Name=SWU00950|organism=Gossypium hirsutum|type=genetic_marker|length=131bp
GGAGTCTTGGTGGGCTTAGCTCGGTGCCTGXAGCTGGTACCGAGTGGACA
AACTCAAACTCAAACTCAGAGTCAGGGGATACTAGTTATGGAAATAGTAA
CGTATATGTCAGCACAATGCCGCCTACACTT