SWU00749

Marker Overview
NameSWU00749
AliasSWU0749
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
Repeat Motif(AAC)3
Primer 1SWU00749_F: CAGCAACAGCTTGATAATCT
Primer 2SWU00749_R: CTTGGCTCTCCGTAGAAG
Product Length146
Publication[view all]
Commentmarker sequence confirmed
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr24N/AAD_chr.24115.9SWU0749View
2CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr13N/AAt.1323.58SWU00749-23.584View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
SWU00749_RSWU00749.SWU00749_RGossypium hirsutumprimer
SWU00749_FSWU00749.SWU00749_FGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SWU0749SWU0749Gossypium hirsutummarker_locus
SWU00749SWU00749-23.584Gossypium hirsutummarker_locus


Sequence
>SWU00749 ID=SWU00749|Name=SWU00749|organism=Gossypium hirsutum|type=genetic_marker|length=146bp
CAGCAACAGCTTGATAATCTACGTAGAAAGGAACGAATGCTAGAGGAAGA
AAACAACAACATGTATCGTTGGATTCAAGAACACCGAGCGGCAATCGAGC
ATCATCAACAAGTTCTTGATGAATTCCCCTTCTACGGAGAGCCAAG