SWU00738

Marker Overview
NameSWU00738
AliasSWU0738
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
Repeat Motif(TTC)3
Primer 1SWU00738_F: ACCAATTCCAACTCCTACTG
Primer 2SWU00738_R: AGCACACCTTCTCCTCAA
Product Length151
Publication[view all]
Commentmarker sequence confirmed
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Yumian-1 x T586, RIL (2015)YT-RIL.15_chr13N/AAD_chr.134.9SWU00738View
2GX1135 x VGX100-2, RIL (2016)GVG-RIL_chr18-1N/AAD_chr.188.2SWU0738View
3CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr18N/AAD_chr.184.2SWU0738View
4CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr18N/ADt.130.59SWU00738-0.586View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
SWU00738_FSWU00738.SWU00738_FGossypium hirsutumprimer
SWU00738_RSWU00738.SWU00738_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SWU00738SWU00738Gossypium hirsutummarker_locus
SWU0738SWU0738Gossypium hirsutummarker_locus
SWU00738SWU00738-0.586Gossypium hirsutummarker_locus


Sequence
>SWU00738 ID=SWU00738|Name=SWU00738|organism=Gossypium hirsutum|type=genetic_marker|length=151bp
ACCAATTCCAACTCCTACTGTTTCTTCTTCTCCATCCCTTTCTCCCAATT
CTTCGATCTCTTCGAACTCACCACCTTCTCCACCGTTGTCGCCCCCGCTG
GTGGTTATTAGCCCATGTGCCGCTTGCAAAATTTTGAGGAGAAGGTGTGC
T