SWU00520

Marker Overview
NameSWU00520
AliasSWU0520
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
Repeat Motif(GCC)3
Primer 1SWU00520_F: GATGCTGGTGAAGATTGG
Primer 2SWU00520_R: CTCATCACAAGAAACTGGAA
Product Length141
Publication[view all]
Commentmarker sequence confirmed
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Yumian-1 x T586, RIL (2015)YT-RIL.15_chr24N/AAD_chr.24108.9SWU00520View
2CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr24N/AAD_chr.2429SWU0520View
3CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr24N/ADt.0891.34SWU00520-91.342View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
SWU00520_RSWU00520.SWU00520_RGossypium hirsutumprimer
SWU00520_FSWU00520.SWU00520_FGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SWU00520SWU00520Gossypium hirsutummarker_locus
SWU0520SWU0520Gossypium hirsutummarker_locus
SWU00520SWU00520-91.342Gossypium hirsutummarker_locus


Sequence
>SWU00520 ID=SWU00520|Name=SWU00520|organism=Gossypium hirsutum|type=genetic_marker|length=141bp
GATGCTGGTGAAGATTGGGATTGTAACTTCCAAAACTTAGAGCCGCCGCC
TGCTAATGTTTTGGCTAGCTTGTCTTCTGGTTTTTGTGGCGATTTTTTCA
GTGATACTTTGGAGAATAAGTTTCCAGTTTCTTGTGATGAG