SWU00514

Marker Overview
NameSWU00514
AliasSWU0514
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
Repeat Motif(AAG)4
Primer 1SWU00514_F: TGAGTCACGGCTTCTGAT
Primer 2SWU00514_R: CCTAACAGCTTGTCCAGTT
Product Length133
Publication[view all]
Commentmarker sequence confirmed
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1GX1135 x GX100-2, RIL (2015)GG-RIL.15_chr26-1N/AAD_chr.26148.7SWU0514View
2GX1135 x GX100-2, RIL (2016)GG-RIL.16_chr26-1N/AAD_chr.26148.7SWU0514View
3CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr19N/AAD_chr.19130.4SWU0514View
4CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr19N/ADt.05123.08SWU00514-123.076View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
SWU00514_RSWU00514.SWU00514_RGossypium hirsutumprimer
SWU00514_FSWU00514.SWU00514_FGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SWU0514SWU0514Gossypium hirsutummarker_locus
SWU00514SWU00514-123.076Gossypium hirsutummarker_locus


Sequence
>SWU00514 ID=SWU00514|Name=SWU00514|organism=Gossypium hirsutum|type=genetic_marker|length=133bp
TGAGTCACGGCTTCTGATCAAATTACCGAAACAAGGCAATCCAGAACATA
AGAAGAAGAAGATCAAGTTATCGGTTTCAGCTGCAGCAGCCATTGCTGAT
AATAGTCAAAATCCAACTGGACAAGCTGTTAGG