PGML4823

Marker Overview
NamePGML4823
Genbank IDN/A
TypeSSR
SpeciesGossypium raimondii
Repeat Motif(AAAT)3
Primer 1PGML4823_F: CCACGTAATTTCTTGAATTGGA
Primer 2PGML4823_R: ATCATGCATGGGACAGACCT
Product Length102
Publication[view all]
CommentBAC_ID=FITC118603.b1
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Yumian-1 x 7235, RIL (2015)Y7-RIL_chr01N/AAD_chr.0115.5PGML4823View
2CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr01N/AAD_chr.0138.6PGML4823View
3CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr01N/AAt.0181.05PGML4823-81.049View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
PGML4823_FPGML4823.PGML4823_FGossypium raimondiiprimer
PGML4823_RPGML4823.PGML4823_RGossypium raimondiiprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PGML4823PGML4823Gossypium raimondiimarker_locus
PGML4823PGML4823-81.049Gossypium raimondiimarker_locus


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
CM017701.1chromosomeCM017701.1:61706939..61707040 -
CM017701.1chromosomeCM017701.1:61711044..61711145 -
CM017649.1chromosomeCM017649.1:63737581..63737682 -
CM017649.1chromosomeCM017649.1:63741685..63741786 -
CM017623.1chromosomeCM017623.1:62251068..62251169 -
CM017623.1chromosomeCM017623.1:62254547..62254648 -
D01chromosomeD01:61935776..61935877 -
D01chromosomeD01:61940014..61940115 -
Gbar_D01chromosomeGbar_D01:61294722..61294823 -
Gbar_D01chromosomeGbar_D01:61298828..61298929 -
D01chromosomeD01:59649846..59649947 -
D01chromosomeD01:62876428..62876529 -
D01chromosomeD01:62923746..62923847 -
Ghir_D01chromosomeGhir_D01:61445302..61445403 -
D01chromosomeD01:59724326..59724427 -
Dt_chr9chromosomeDt_chr9:50937834..50937935 +
CM016614.1chromosomeCM016614.1:135331897..135331996 -
CM016614.1chromosomeCM016614.1:135327704..135327805 -
CM016614.1chromosomeCM016614.1:135336102..135336203 -
CM016614.1chromosomeCM016614.1:135323506..135323607 -
D10_01chromosomeD10_01:1577207..1577308 -
D10_01chromosomeD10_01:1596539..1596640 +
scaffold294supercontigscaffold294:35966..36067 +
scaffold294supercontigscaffold294:31856..31957 +
Chr02_CRI-A2_v1.0.a1chromosomeChr02_CRI-A2_v1.0.a1:97663933..97664034 -
Chr2chromosomeChr2:68841285..68841386 -
D5_01chromosomeD5_01:54947105..54947206 -
D5_01chromosomeD5_01:54951208..54951309 -
CM018215.1chromosomeCM018215.1:61045905..61046006 -
CM018215.1chromosomeCM018215.1:61050011..61050112 -
D01chromosomeD01:62599683..62599784 -
Sequence
>PGML4823 ID=PGML4823|Name=PGML4823|organism=Gossypium raimondii|type=genetic_marker|length=102bp
CCACGTAATTTCTTGAATTGGAACAGAATTATAGGGACTAAATAAATAAA
TAATGTAGCTAGTGCTTATTTAGCCATTGTCAAGGTCTGTCCCATGCATG
AT