PGML4648

Marker Overview
NamePGML4648
Genbank IDN/A
TypeSSR
SpeciesGossypium raimondii
Repeat Motif(ACCCG)4
Primer 1PGML4648_F: CCTCTCCATGATGCTCCTTC
Primer 2PGML4648_R: GATAGGCGCCAATGAATAAA
Product Length171
Publication[view all]
CommentBAC_ID=FITC140603.g1
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Yumian-1 x T586, RIL (2015)YT-RIL.15_chr25N/AAD_chr.2536.8PGML4648View
2Yumian-1 x 7235, RIL (2015)Y7-RIL_chr25N/AAD_chr.2559.3PGML4648View
3CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr25N/AAD_chr.250PGML4648View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
PGML4648_RPGML4648.PGML4648_RGossypium raimondiiprimer
PGML4648_FPGML4648.PGML4648_FGossypium raimondiiprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PGML4648PGML4648Gossypium raimondiimarker_locus


Sequence
>PGML4648 ID=PGML4648|Name=PGML4648|organism=Gossypium raimondii|type=genetic_marker|length=171bp
CCTCTCCATGATGCTCCTTCATTGGCGCCTACTAGACAGGCGCCACCCGA
CCCGACCCGACCCGACCCAACCGTATTTTGACCTGTATTTTTTTAAAAAA
ATATTAAAAAAGGTATAAAATTATATTTTATTCAAAAAAAATTATTATTA
TTTTATTCATTGGCGCCTATC