PGML4534

Marker Overview
NamePGML4534
Genbank IDN/A
TypeSSR
SpeciesGossypium raimondii
Repeat Motif(AAAAAT)6
Primer 1PGML4534_F: ACCCAATTTCAAACACACGA
Primer 2PGML4534_R: CAAGTCTTGGTGCATGTGCT
Product Length338
Publication[view all]
CommentBAC_ID=FITC161705.b1
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Yumian-1 x 7235, RIL (2015)Y7-RIL_chr07N/AAD_chr.0754PGML4534View
2CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr07N/AAD_chr.07104.4PGML4534View
3CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr19N/ADt.0511.17PGML4534-11.168View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
PGML4534_FPGML4534.PGML4534_FGossypium raimondiiprimer
PGML4534_RPGML4534.PGML4534_RGossypium raimondiiprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PGML4534PGML4534Gossypium raimondiimarker_locus
PGML4534PGML4534-11.168Gossypium raimondiimarker_locus


Sequence
>PGML4534 ID=PGML4534|Name=PGML4534|organism=Gossypium raimondii|type=genetic_marker|length=338bp
ACCCAATTTCAAACACACGAACGAAGAACAACAAAAAGTTTGTAGAAATT
AGAGGAGATAACATCAAAAACTTAGTCAATCTCTTTCCAATCAAATCAAC
GAACAACATAACCCTCAGTTAGACCTGATAGCAAAATTATCAAAGCAAAT
CAAAAGTCAAGAAAAAGAAAAACAAAGAAAATGAAAAAGAATAAGAAATA
AGAAAAATAAAAATAAAAATAAAAATAAAAATAAAAATAAAAGAAGAAGG
AACATTAATTGAACCTTTTTAATTGAAACAAATAACTAAAATTCTGACTG
TTAGCAAAAATATTTTTTAGCACATGCACCAAGACTTG