PGML4533

Marker Overview
NamePGML4533
Genbank IDN/A
TypeSSR
SpeciesGossypium raimondii
Repeat Motif(TCTTCA)3
Primer 1PGML4533_F: CATGCCTAGGGTTCCTTTGA
Primer 2PGML4533_R: AAGGAAATCAACATCGAGTGC
Product Length101
Publication[view all]
CommentBAC_ID=FITC111912.b1
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr26N/AAD_chr.2692.6PGML4533View
2CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr26N/ADt.1273.71PGML4533-73.712View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
PGML4533_FPGML4533.PGML4533_FGossypium raimondiiprimer
PGML4533_RPGML4533.PGML4533_RGossypium raimondiiprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PGML4533PGML4533Gossypium raimondiimarker_locus
PGML4533PGML4533-73.712Gossypium raimondiimarker_locus


Sequence
>PGML4533 ID=PGML4533|Name=PGML4533|organism=Gossypium raimondii|type=genetic_marker|length=101bp
CATGCCTAGGGTTCCTTTGAACAATTTGGGTTGTTGGCTCATCATCGTCA
TCGTCTTCATCTTCATCTTCATCTTCCTGTGCACTCGATGTTGATTTCCT
T