PGML4301

Marker Overview
NamePGML4301
Genbank IDN/A
TypeSSR
SpeciesGossypium raimondii
Repeat Motif(TTGTT)3
Primer 1PGML4301_F: GTGGACTTGTGAAATGGGCT
Primer 2PGML4301_R: GCCGCACATGGTGAGATAA
Product Length306
Publication[view all]
CommentBAC_ID=FITC109374.g1
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Yumian-1 x 7235, RIL (2015)Y7-RIL_chr18N/AAD_chr.1823.9PGML4301View
2CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr18N/AAD_chr.1855.5PGML4301View
3CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr18N/ADt.1352.96PGML4301-52.956View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
PGML4301_RPGML4301.PGML4301_RGossypium raimondiiprimer
PGML4301_FPGML4301.PGML4301_FGossypium raimondiiprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PGML4301PGML4301Gossypium raimondiimarker_locus
PGML4301PGML4301-52.956Gossypium raimondiimarker_locus


Sequence
>PGML4301 ID=PGML4301|Name=PGML4301|organism=Gossypium raimondii|type=genetic_marker|length=306bp
GTGGACTTGTGAAATGGGCTGATTTGCGAGCTATCAACTTTAAGGACTAA
ATTAAGAAGGCTTGAATTTATAAATGACTAATGTGACAATTATGCCAATT
TGAATTTAAATTCCACTTAAACATTAAATGCGACAGACTTGTTTTGTTTT
GTTAGGATTGCTTTAGTATTATTAGATTTACTTTTAGTATATATATGTAT
GTTGAGGGAGTAGCCAAAGTAGAGAAAAAATGATTAGTTTTGACTTCTTT
TTCTTTTCACTTTCAATTAGCAGTTACTTGTGAATTTTTATCTCACCATG
TGCGGC