PGML4051

Marker Overview
NamePGML4051
Genbank IDN/A
TypeSSR
SpeciesGossypium raimondii
Repeat Motif(AGC)5
Primer 1PGML4051_F: ATTCAGAGAGAACCGCCAGA
Primer 2PGML4051_R: CGGAGATTATATTGCCGGTG
Product Length194
Publication[view all]
CommentBAC_ID=FITC48588.b1
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Yumian-1 x T586, RIL (2015)YT-RIL.15_chr05N/AAD_chr.0526.7PGML4051View
2Yumian-1 x 7235, RIL (2015)Y7-RIL_chr05N/AAD_chr.0522.6PGML4051View
3CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr05N/AAD_chr.0574.3PGML4051View
4CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr05N/AAt.0566.52PGML4051-66.518View
Relationships

This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber strengthqFS.CY-RIL_ch05.swu08Gossypium hirsutumQTL
fiber strengthqFS.CY-RIL_ch05.swu12Gossypium hirsutumQTL


This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
PGML4051_FPGML4051.PGML4051_FGossypium raimondiiprimer
PGML4051_RPGML4051.PGML4051_RGossypium raimondiiprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PGML4051PGML4051Gossypium raimondiimarker_locus
PGML4051PGML4051-66.518Gossypium raimondiimarker_locus


Sequence
>PGML4051 ID=PGML4051|Name=PGML4051|organism=Gossypium raimondii|type=genetic_marker|length=194bp
ATTCAGAGAGAACCGCCAGATATATACCTCATAATCATATATATAAAAGA
GCTATTAAAAGAAGAAAAGGAAAAGAATAAAATCAGTAAAACGTAAATAA
ATAAAAAAACTATACGTTAGTTGTGGTAGCAGCAGCAGCAGCGGTGGTGG
CAGTAGCAACATTAGCAGCAGTTCCACCGGCAATATAATCTCCG