PGML4005

Marker Overview
NamePGML4005
Genbank IDN/A
TypeSSR
SpeciesGossypium raimondii
Repeat Motif(T)29
Primer 1PGML4005_F: ACAGCCTTTCGTGTGTGAAA
Primer 2PGML4005_R: CACGCACGGTTTAAATGCTA
Product Length228
Publication[view all]
CommentBAC_ID=FITC31383.g1
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr26N/AAD_chr.2625.6PGML4005View
2CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr26N/ADt.12145.07PGML4005-145.068View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
PGML4005_RPGML4005.PGML4005_RGossypium raimondiiprimer
PGML4005_FPGML4005.PGML4005_FGossypium raimondiiprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PGML4005PGML4005Gossypium raimondiimarker_locus
PGML4005PGML4005-145.068Gossypium raimondiimarker_locus


Sequence
>PGML4005 ID=PGML4005|Name=PGML4005|organism=Gossypium raimondii|type=genetic_marker|length=228bp
ACAGCCTTTCGTGTGTGAAACATTTTTTTTTTTTTTTTTTTTTTTTTTTT
TGAACACGAGTGCAAAGGTAATAAATAACTGAGACAGAACATAAATGTGG
CTCCATTTCACAACTCATATTTTTTTCATAAATTTTTTTAAGAGACTCGA
GTTTTGAAGACGCTCATTTCAGCTAAATAATAATTATTCTCATTGCACAT
TAACTTTTTAGCATTTAAACCGTGCGTG