PGML3030

Marker Overview
NamePGML3030
Genbank IDN/A
TypeSSR
SpeciesGossypium raimondii
Repeat Motif(ATA)13
Primer 1PGML3030_F: TGAAAGCGGTAAACAAATATATAAAC
Primer 2PGML3030_R: TGAAGCTGTGCGTATTGGAG
Product Length270
Publication[view all]
CommentBAC_ID=FITC156245.g1
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr23N/AAD_chr.2381.9PGML3030View
2CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr23N/ADt.09106PGML3030-105.996View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
PGML3030_RPGML3030.PGML3030_RGossypium raimondiiprimer
PGML3030_FPGML3030.PGML3030_FGossypium raimondiiprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PGML3030PGML3030Gossypium raimondiimarker_locus
PGML3030PGML3030-105.996Gossypium raimondiimarker_locus


Sequence
>PGML3030 ID=PGML3030|Name=PGML3030|organism=Gossypium raimondii|type=genetic_marker|length=270bp
TGAAAGCGGTAAACAAATATATAAACTAATACCATAATAATAATAATAAT
AATAATAATAATAATAATAATACAAGATTAATGGAATAATATAAAAATGA
TAATAACATTAAAATAAATAATTAAATAATAAAATAGCTAAAATGGACTA
AAATGGAAAAAATTGGGGAGGATTCGAAAATAAATAAAAGGGGAGGACCA
CTTTGAATGCGCGACTAACAAGGAGGGACCAAATGGGAATAATCCCGTCC
CTCCAATACGCACAGCTTCA