PGML2824

Marker Overview
NamePGML2824
Genbank IDN/A
TypeSSR
SpeciesGossypium raimondii
Repeat Motif(A)16
Primer 1PGML2824_F: TAAACCGGTGAGGAGTCAGC
Primer 2PGML2824_R: CCATTTATGCACAGAGACCG
Product Length376
Publication[view all]
CommentBAC_ID=FITC175617.b1
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr15N/AAD_chr.1590.1PGML2824View
2CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr15N/ADt.0185.3PGML2824-85.3View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
PGML2824_FPGML2824.PGML2824_FGossypium raimondiiprimer
PGML2824_RPGML2824.PGML2824_RGossypium raimondiiprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PGML2824PGML2824Gossypium raimondiimarker_locus
PGML2824PGML2824-85.3Gossypium raimondiimarker_locus


Sequence
>PGML2824 ID=PGML2824|Name=PGML2824|organism=Gossypium raimondii|type=genetic_marker|length=376bp
TAAACCGGTGAGGAGTCAGCCGACGAGGACCAAGTTTTCAACCTAATGAT
AGAGGATTGAAGTATCGAGAAAAAAGAACAGGAAAATATGAAAATTATGA
TATTGGTTTTTAGATGTTTCAATTTTTGGTGTATATCCTCGATCAAATTG
AGCAGATAAATTTATTTTTTTAAAACTTATTCAGTGTAAGGGTCACAATA
AAAAAAAAAAAAAAATTACAAAAAAAAGACTAAATTATACAATGTGTAAA
TGCTAATGATTAAATTTTGTAATTTTTTATAATTAGATGACTCTACTATT
AGCTTGACGACTATCAATGTAGTTTACCCTAAATGTTAGGGCACAAAATA
AAGAAACGGTCTCTGTGCATAAATGG