PGML2147

Marker Overview
NamePGML2147
Genbank IDN/A
TypeSSR
SpeciesGossypium raimondii
Repeat Motif(AAT)10
Primer 1PGML2147_F: TCTTACCCGTGTCAATGCAA
Primer 2PGML2147_R: TACAAGCAGTCGCAGAGCAT
Product Length276
Publication[view all]
CommentBAC_ID=FITC24612.b1
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr10N/AAD_chr.1015.2PGML2147View
2CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr10N/AAt.1012.02PGML2147-12.02View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
PGML2147_FPGML2147.PGML2147_FGossypium raimondiiprimer
PGML2147_RPGML2147.PGML2147_RGossypium raimondiiprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PGML2147PGML2147Gossypium raimondiimarker_locus
PGML2147PGML2147-12.02Gossypium raimondiimarker_locus


Sequence
>PGML2147 ID=PGML2147|Name=PGML2147|organism=Gossypium raimondii|type=genetic_marker|length=276bp
TCTTACCCGTGTCAATGCAAAACAGTTTCCAAAAGGCAGAAATTCATTTA
AAACAGACATTAATACAAGCTTCTGTACATAATTACCGAAATGAACATGA
ACCCAAAATAATAATAATAATAATAATAATAATAATAAGCAGCTCACATC
TTTCTTTAGGACAGGCAATACCCTCTCCCACTGGTTTTTTTTTTTACAAA
ATCATAAAAAATTCGTGTGTTTCTTTTTATTATAAATTAAGACAAACGAG
AAGGAGATGCTCTGCGACTGCTTGTA