PGML2007

Marker Overview
NamePGML2007
Genbank IDN/A
TypeSSR
SpeciesGossypium raimondii
Repeat Motif(TCTTT)3
Primer 1PGML2007_F: GCTCTGCCAATACTCGAAGG
Primer 2PGML2007_R: TCGCAAAGTCAACAGTCTGC
Product Length319
Publication[view all]
CommentBAC_ID=FITC108318.g1
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Yumian-1 x T586, RIL (2015)YT-RIL.15_chr25N/AAD_chr.2592.1PGML2007aView
2Yumian-1 x T586, RIL (2015)YT-RIL.15_chr16N/AAD_chr.1683.9PGML2007bView
3CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr25N/AAD_chr.2519.4PGML2007View
4CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr25N/ADt.0677.31PGML2007-77.305View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
PGML2007_FPGML2007.PGML2007_FGossypium raimondiiprimer
PGML2007_RPGML2007.PGML2007_RGossypium raimondiiprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PGML2007aPGML2007aGossypium raimondiimarker_locus
PGML2007bPGML2007bGossypium raimondiimarker_locus
PGML2007PGML2007Gossypium raimondiimarker_locus
PGML2007PGML2007-77.305Gossypium raimondiimarker_locus


Sequence
>PGML2007 ID=PGML2007|Name=PGML2007|organism=Gossypium raimondii|type=genetic_marker|length=319bp
GCTCTGCCAATACTCGAAGGGAAGGAATATCAACTTCGACGGGTAAAAAA
AATGCCTCTATTCCATATACCAATGAGAAATGAGTTGCCCAGTAGAGTTT
TTTTGTATTTTTTATTTTTTTCTCTTTTCTTTTCTTTTTTTTATTTTTGC
CTCTACTGTATCATTCACTTTGGGGCGATAAATCATTTAATCTCGAACAG
ACTGCAAACTTTTGATACCGTGCTGTTGTTCAATTTTAGTGCATTTTCAG
ATATGCCCCTTTTTGGCATTTCATACTAACATATGATTTTCAAGAATTCG
CAGACTGTTGACTTTGCGA