PGML1675

Marker Overview
NamePGML1675
Genbank IDN/A
TypeSSR
SpeciesGossypium raimondii
Repeat Motif(TATGA)3
Primer 1PGML1675_F: TTTACGCTTTGGCTCTAGCA
Primer 2PGML1675_R: TTACCTGGCAGCAGTAGGCT
Product Length319
Publication[view all]
CommentBAC_ID=FITC184975.b1
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Yumian-1 x T586, RIL (2015)YT-RIL.15_chr26N/AAD_chr.2639.9PGML1675View
2Yumian-1 x 7235, RIL (2015)Y7-RIL_chr26N/AAD_chr.26105.1PGML1675View
3CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr26N/AAD_chr.26117.7PGML1675View
4CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr26N/ADt.1255.73PGML1675-55.73View
Relationships

This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
upper half mean lengthqUHML.CY-RIL.17_ch26.ay14Gossypium hirsutumQTL


This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
PGML1675_FPGML1675.PGML1675_FGossypium raimondiiprimer
PGML1675_RPGML1675.PGML1675_RGossypium raimondiiprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PGML1675PGML1675Gossypium raimondiimarker_locus
PGML1675PGML1675-55.73Gossypium raimondiimarker_locus


Sequence
>PGML1675 ID=PGML1675|Name=PGML1675|organism=Gossypium raimondii|type=genetic_marker|length=319bp
TTTACGCTTTGGCTCTAGCAGTAAATTTCTTCTTCTCTGGTCTTCCAAGT
GCATTATTATAATACCAAACAAGCTTCACCTATACATATAAATTGAAATG
AACTAATTAAAGTGACATAATAAATATACATCTAACAATGTTAGACACAA
TAAGTAAAGTTTAAATAAAGAATTTATGACAACAAATTATGATATGATAT
GAAGACATAAATGCTCTGAAATTAAAAAAATGACTTGTAAATAATGAGAC
AACAATAGAAAATACTAGAAAGGAATTAACAAACAAGGAACCTGTTTTCA
GCCTACTGCTGCCAGGTAA