PGML1326

Marker Overview
NamePGML1326
Genbank IDN/A
TypeSSR
SpeciesGossypium raimondii
Repeat Motif(A)15
Primer 1PGML1326_F: GTTTCCTCCGTTCTGACTCG
Primer 2PGML1326_R: CTTGACGGAATCTTAACTGCC
Product Length235
Publication[view all]
CommentBAC_ID=FITC153877.b1
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr20N/AAD_chr.208.9PGML1326View
2CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr20N/ADt.1015.02PGML1326-15.022View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
PGML1326_RPGML1326.PGML1326_RGossypium raimondiiprimer
PGML1326_FPGML1326.PGML1326_FGossypium raimondiiprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PGML1326PGML1326Gossypium raimondiimarker_locus
PGML1326PGML1326-15.022Gossypium raimondiimarker_locus


Sequence
>PGML1326 ID=PGML1326|Name=PGML1326|organism=Gossypium raimondii|type=genetic_marker|length=235bp
GTTTCCTCCGTTCTGACTCGGTCAACTAGTCCACGCTTCAGTCACTGACT
CACTGACTCGTGTGTTATTGCAGGGAGGGGAAGATCGCTCCGGTTGGATT
CTTCGAGAAGTATCCTGCTCTTGTTACCGGATTTTTCTTCTTCATGTGGT
AAGTTACGTAAGCACAAAAAAAAAAAAAAACCGTTCAACGATACACTTTC
AAATGAGTCAAAACGGCAGTTAAGATTCCGTCAAG